ID: 1070864728

View in Genome Browser
Species Human (GRCh38)
Location 10:79700904-79700926
Sequence GCCAGACAACGCCCCCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070864716_1070864728 28 Left 1070864716 10:79700853-79700875 CCCGCTGGAGATGTGGAAATGGA No data
Right 1070864728 10:79700904-79700926 GCCAGACAACGCCCCCTCATTGG No data
1070864714_1070864728 29 Left 1070864714 10:79700852-79700874 CCCCGCTGGAGATGTGGAAATGG No data
Right 1070864728 10:79700904-79700926 GCCAGACAACGCCCCCTCATTGG No data
1070864726_1070864728 -6 Left 1070864726 10:79700887-79700909 CCTGGGTGCTTCCTGGGGCCAGA No data
Right 1070864728 10:79700904-79700926 GCCAGACAACGCCCCCTCATTGG No data
1070864717_1070864728 27 Left 1070864717 10:79700854-79700876 CCGCTGGAGATGTGGAAATGGAG No data
Right 1070864728 10:79700904-79700926 GCCAGACAACGCCCCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070864728 Original CRISPR GCCAGACAACGCCCCCTCAT TGG Intergenic