ID: 1070865510

View in Genome Browser
Species Human (GRCh38)
Location 10:79706151-79706173
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 4, 1: 1, 2: 0, 3: 26, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070865510_1070865513 -8 Left 1070865510 10:79706151-79706173 CCTTGTGACTGCAGGGGCTCCTC 0: 4
1: 1
2: 0
3: 26
4: 196
Right 1070865513 10:79706166-79706188 GGCTCCTCCAGGCGGCCCTCTGG 0: 4
1: 2
2: 4
3: 30
4: 306
1070865510_1070865518 22 Left 1070865510 10:79706151-79706173 CCTTGTGACTGCAGGGGCTCCTC 0: 4
1: 1
2: 0
3: 26
4: 196
Right 1070865518 10:79706196-79706218 TACCTTCCCCAGCACACCTCTGG 0: 3
1: 2
2: 1
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070865510 Original CRISPR GAGGAGCCCCTGCAGTCACA AGG (reversed) Exonic
900538277 1:3189806-3189828 CAGCAGCCCCTGCAGGAACAGGG + Intronic
901529080 1:9842495-9842517 CTGGAGCCCCTGAGGTCACATGG - Intergenic
904052882 1:27650821-27650843 AAGGAGCCCATGTGGTCACATGG + Intergenic
904455782 1:30647268-30647290 GAGGAGGCCCAGCAGTTACAGGG + Intergenic
905328057 1:37171954-37171976 GAGGAGCCCAGGGGGTCACAGGG - Intergenic
905460285 1:38118403-38118425 CGGGAGCCACTGCAGACACAGGG - Intergenic
906202196 1:43967414-43967436 AAGGAGGCCCTGCAGCCACCTGG + Exonic
907726092 1:57021911-57021933 GTGGAGCCCCTGTAGTCACGAGG - Intronic
910173448 1:84402406-84402428 GAGGAGCCTCTGCTGTTACAGGG + Intronic
913124184 1:115770088-115770110 AAGGCTCCCCTGCAGTCAGACGG + Intergenic
916166095 1:161968631-161968653 GAGGTGCTGCTGCAGTCTCAGGG - Intergenic
922799104 1:228356220-228356242 CAGGAGGCACTGCAGTCAGAAGG - Intronic
922898711 1:229120184-229120206 GAGGAGCCTCTCCAGCCACAAGG + Intergenic
924483379 1:244456323-244456345 GTGGAGCCCCTGGAGGAACAGGG - Intronic
1063835350 10:10005791-10005813 GTGGTGCCCATGAAGTCACAAGG + Intergenic
1064440426 10:15348528-15348550 TAGGACCCCTTGCAGTCACCAGG + Intronic
1067944017 10:50679282-50679304 GAGGAACCCCTGCAGTCACAAGG - Intergenic
1070865510 10:79706151-79706173 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1070879304 10:79844282-79844304 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1071632410 10:87228372-87228394 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1071645863 10:87360590-87360612 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1073386887 10:103133232-103133254 GTGGAGCCACTCCAGCCACATGG + Intronic
1074183403 10:111082130-111082152 GAGGAGTTCCTGCCGTCACCTGG + Intergenic
1075834618 10:125443121-125443143 GAGGAGCCCAGCCAGCCACAGGG - Intergenic
1076981685 11:208181-208203 GAGGAGCCACTCCAGGCAGAAGG - Intronic
1077464873 11:2728979-2729001 TGGGAGCCACTGCAGACACAGGG + Intronic
1078012748 11:7585757-7585779 GAACAGCCACTGCAGTCAGAGGG + Intronic
1078467114 11:11558639-11558661 TGGGAGCCCCTGCAGCCAGAGGG + Intronic
1078487579 11:11738306-11738328 TAGGAGGCTCTCCAGTCACAGGG - Intergenic
1078631921 11:13010684-13010706 GAGGAGCCCCTGGAGCCCGACGG + Intergenic
1080780280 11:35422829-35422851 AAGGAGACCCTGGGGTCACACGG - Intergenic
1080897800 11:36460805-36460827 GAGGTGCCCCGGCAGGCAGATGG - Intronic
1081871240 11:46383513-46383535 AAGGAGCCCCTGGTGTCACATGG + Exonic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1083147456 11:60769909-60769931 GAGGAGGCCCTGGGGTGACACGG - Intronic
1084550405 11:69838055-69838077 GAGGAGCCCATGCACTGACTGGG + Intergenic
1084584453 11:70049251-70049273 CAGAAGCCCCTGTAGTCATATGG + Intergenic
1087021582 11:93608535-93608557 GAGCAGGCCCTGAAGGCACAAGG - Intergenic
1089126342 11:116179103-116179125 CAGGAGGCCCTCAAGTCACACGG - Intergenic
1090003669 11:122982056-122982078 AAGCAGCCCCTGCAGTGACGGGG - Intergenic
1095079655 12:37984236-37984258 TAGGAGCCCATGTAGTCCCATGG + Intergenic
1096047258 12:48573376-48573398 CATGAGCCACTGCAGGCACAAGG - Intergenic
1098777089 12:74634493-74634515 GGGGAGCTAGTGCAGTCACATGG + Intergenic
1102072684 12:110034896-110034918 AAGCAGCCCCTGCCCTCACAGGG + Intronic
1102399766 12:112618249-112618271 AAGAAGCCCCTGCAGTGACAAGG - Intronic
1102579467 12:113877077-113877099 GGGCTGCCCCTGCAGCCACAAGG + Intronic
1105805883 13:23951377-23951399 GAGGAGCCTCTGGGGTCCCACGG + Intergenic
1106808494 13:33335468-33335490 GTGGAGGTCCTGCAGTCACTGGG + Intronic
1107234860 13:38155724-38155746 GAGCAGCCACTGCCGTCATAAGG + Intergenic
1109346001 13:61114898-61114920 GTGGAGCCCCTGGAGGAACAGGG - Intergenic
1112033710 13:95478843-95478865 GAGCAACTCCTGAAGTCACATGG - Intronic
1113871270 13:113561322-113561344 GAGGTGCCCATGCAGTCCCCAGG - Intergenic
1113987729 13:114331836-114331858 GAGCAGCCTCTGCAGTTAGAAGG - Intergenic
1114367563 14:22046373-22046395 GAGGAGCCCCTGAGGTCCCCTGG + Intergenic
1114635559 14:24184903-24184925 GAGGAACCCCAGCAGTCCCCGGG - Exonic
1119783639 14:77296337-77296359 GAGGAGCCTCGGAAGCCACAGGG + Intronic
1121765188 14:96479838-96479860 GAGCAGCCCCTGGAGGCCCAAGG - Intronic
1122546303 14:102524607-102524629 GAGGAGCCCAGGCAGCCGCAGGG - Intergenic
1124218409 15:27828379-27828401 GAGGAGCCCCTGCCCTCAGAGGG - Intronic
1125397811 15:39269379-39269401 GTGGAGCCCCAGCAGTCCCCAGG - Intergenic
1128283886 15:66419682-66419704 GAGGAGCCTCTGGAGTCATGAGG - Intronic
1128606341 15:69039215-69039237 GAGAAGCCTTTGCAGACACAGGG + Intronic
1129021298 15:72521636-72521658 GAGGATCCCTTGAACTCACAAGG - Intronic
1129256717 15:74337944-74337966 GAGGATGGCCTGCAGCCACATGG - Exonic
1129270075 15:74414938-74414960 GAGTAGTTCCTGCAGTGACATGG + Exonic
1129757773 15:78108884-78108906 GCGCAGCCCATGCAGACACAGGG - Intronic
1130563544 15:84976976-84976998 GTGAAACCTCTGCAGTCACAGGG - Intergenic
1134656987 16:15954637-15954659 ATGGAGCCACTGCAGCCACAGGG + Intronic
1135715571 16:24762819-24762841 AAACAGCCCCTGCAGTTACATGG + Intronic
1136491317 16:30610116-30610138 GAGGAGCCCCTGCCGGACCAGGG + Exonic
1137271592 16:46905983-46906005 GAGGATGCCTTGCAGTCCCAGGG + Intronic
1137864538 16:51879718-51879740 CAGAAGCCCCTGCAGTGACCGGG + Intergenic
1138575480 16:57904682-57904704 GAGGGGGCCCTGCAGTCAGGTGG + Intronic
1140217794 16:73022370-73022392 GAGGAGCCACTGCAGGCCCCTGG + Intronic
1140293300 16:73684669-73684691 CATGTGCCCCTGCAATCACAAGG + Intergenic
1144829576 17:18123772-18123794 GAGGAGACCCTGCAGCCCAAAGG + Intronic
1145865774 17:28240714-28240736 CAGGAGGCCCTGGAGGCACATGG + Intergenic
1145941241 17:28744361-28744383 GGGGCGCCCCTGAGGTCACAGGG - Intronic
1146902960 17:36600199-36600221 GAGGAGCTCCCACAGTCACTAGG - Exonic
1148093925 17:45039582-45039604 GAAGACTTCCTGCAGTCACATGG - Intronic
1148328053 17:46795364-46795386 GGGGAGCCCCAGAAGTCACAGGG - Intronic
1148481415 17:47961853-47961875 CAGGAGTGCCTGCAGTCACCAGG - Intergenic
1150458836 17:65330366-65330388 GAGAATCTCCTGCAGTCACAGGG + Intergenic
1151305783 17:73261944-73261966 GAGCGTCCCCTGCAGTCACCTGG - Intronic
1152469160 17:80481424-80481446 GAGGCGCCCCTGGACCCACAGGG + Intergenic
1152544436 17:80993606-80993628 GCTGAGCCCGTGCAGGCACAGGG - Intronic
1154029896 18:10744429-10744451 GAGCAGCCCCTTCACTCCCAGGG - Intronic
1155029034 18:21968213-21968235 GTGGAGCCCGTGCAGGCCCACGG + Intergenic
1155065599 18:22266440-22266462 GCGGAGCTCCCCCAGTCACAAGG + Intergenic
1156327115 18:36084978-36085000 GAGTGGCCGCTGCTGTCACATGG + Intergenic
1158226047 18:55202686-55202708 GAGGAGGTACTGAAGTCACATGG + Intergenic
1160121052 18:76130791-76130813 CAGGAGCACCTGCAGCCACAGGG + Intergenic
1160222279 18:76985927-76985949 AGGAAGCCCCTGCGGTCACACGG - Intronic
1160463294 18:79055473-79055495 AAGGAGCACCTGGAGCCACACGG - Intergenic
1160541091 18:79623454-79623476 GAGGGGCTCCTGCAGACACCGGG + Intergenic
1160541108 18:79623544-79623566 GAGGGGCTCCTGCAGACACGGGG + Intergenic
1160541141 18:79623732-79623754 GAGGGGCTCCTGCAGACACGGGG + Intergenic
1160541179 18:79623962-79623984 GAGGGGCCCCTGCAGACATGGGG + Intergenic
1160541197 18:79624052-79624074 GAGGGGCTCCTGCAGACACGGGG + Intergenic
1161707821 19:5830236-5830258 GAGAAGCCCCTGCAGTTCCCTGG + Intergenic
1161869827 19:6861696-6861718 GAGGAAGCAATGCAGTCACAAGG + Intergenic
1163304493 19:16469350-16469372 GAGGATCGGCTGCAGCCACAGGG + Intronic
1164593816 19:29520649-29520671 GAGGGCCCCCTGCTGTCACCAGG - Intergenic
1165824239 19:38696629-38696651 GAGGAGAGCCTGCACTCACAAGG - Intronic
1166924410 19:46256828-46256850 GAGGAGCGCTAGCTGTCACAGGG - Intergenic
1167613448 19:50518190-50518212 GAGGAGGCCCTGCAGCCGCGGGG - Exonic
1168247575 19:55120925-55120947 GAGGAGGGCCTGCAGTTCCAAGG + Intergenic
1168317324 19:55489974-55489996 GAGGAGCCCCTGGTGACACATGG + Exonic
927633154 2:24791880-24791902 GAGGTGCCGCTGTAGTCAGAAGG - Intronic
927849016 2:26487319-26487341 CAGGAGAGCCTGAAGTCACATGG - Intronic
930771382 2:55133741-55133763 AAGGAGACCCAGCAGCCACACGG + Intergenic
933967515 2:87442146-87442168 GAGGAGTCCCTGATGTCACTTGG + Intergenic
934603671 2:95678408-95678430 GAAGAGCCCCTGCATTTATAGGG + Intergenic
936292327 2:111235776-111235798 GAGGAGACGCTGGAGCCACAGGG + Intergenic
936326280 2:111508350-111508372 GAGGAGTCCCTGATGTCACTTGG - Intergenic
936537051 2:113320646-113320668 GAAGAGCCCCTGCATTTATAGGG + Intergenic
937368942 2:121284795-121284817 GAGGAGCCCTCGCAGACATAGGG + Intronic
938254705 2:129847507-129847529 GCGGGGCACCTGCAGTCCCATGG + Intergenic
938383179 2:130848014-130848036 GAAGAGCCCCTGCAACCACGTGG - Intronic
938522972 2:132091637-132091659 GAGGATCACCTGCAGTCAGGAGG - Intergenic
942127572 2:172842633-172842655 GAGGAAGCCAGGCAGTCACATGG - Intronic
944924811 2:204453928-204453950 GAGGACCACGTTCAGTCACACGG + Intergenic
947285992 2:228515464-228515486 GAGAAGCCCCAGAAGTTACATGG - Intergenic
948037142 2:234866787-234866809 CAGCAGCACCTGTAGTCACATGG - Intergenic
948386096 2:237582002-237582024 TAGGAGCCCCTGCTGTGTCAGGG - Intronic
948658576 2:239492246-239492268 GTGGAGACCCTGCAGCCACTGGG - Intergenic
948664967 2:239529002-239529024 GAGAGGCACCTGCACTCACATGG - Intergenic
948845850 2:240682532-240682554 GAGGAACTCCTGCAGGGACACGG + Exonic
1168771160 20:417801-417823 CAGGAGACCCTGCACTCCCATGG + Exonic
1169092582 20:2870757-2870779 CAGGTGCCCCAACAGTCACAGGG - Intronic
1171308249 20:24124341-24124363 GACAAGCCCTAGCAGTCACAGGG - Intergenic
1171342301 20:24439963-24439985 GAGGAGGCCGAGCAGCCACATGG - Intergenic
1172596973 20:36156251-36156273 GAGGTGCCCCTGAAATCCCAGGG - Intronic
1173836630 20:46130283-46130305 CAGTAGCTCCTGCAGCCACAGGG - Intergenic
1176138323 20:63534707-63534729 GAGAAGCCCCTGCCCTCCCAGGG + Intronic
1176173590 20:63707538-63707560 CAGGAGCCCCTGCAGGCGCCGGG + Intronic
1176201475 20:63862774-63862796 GAGGAGGCCCTGGGGCCACACGG + Exonic
1176206946 20:63894468-63894490 GCGGAGCGCCTGCAGTTACAGGG + Intergenic
1176248064 20:64106785-64106807 AAGGAGCCCCTGCTGTCAAGGGG + Exonic
1178370311 21:32021665-32021687 GAATAGCCCCACCAGTCACAAGG - Intronic
1179383973 21:40924729-40924751 GAGGAGCAGCTTCAGGCACAGGG + Intergenic
1179517474 21:41918606-41918628 GAGCTGCACCTGCAGTCACCTGG - Intronic
1179627429 21:42656566-42656588 GAGGAGCCGCTGCAGCCACTTGG + Intronic
1179675141 21:42975425-42975447 GAAGAGCCGCTTCTGTCACACGG + Intronic
1179962015 21:44772917-44772939 GAGGAGCCCCAGCAGACCCTGGG - Intronic
1181733262 22:24862901-24862923 GAGAAGCCCCTGCAGACCCCTGG - Intronic
1183173058 22:36202033-36202055 GAGGAGGCCCCGCAGCGACATGG - Exonic
1183180209 22:36254937-36254959 GAGGAGGCCCTGCAGCGACATGG + Exonic
1183495539 22:38141442-38141464 GAGGTGACCCTGGTGTCACATGG - Intronic
1184483975 22:44765304-44765326 GAGGTGCCCCTGCATTGCCAGGG + Intronic
1184921257 22:47607474-47607496 GGGGAACACCTGAAGTCACATGG - Intergenic
950450064 3:13060462-13060484 GACCAGCTCCTGCAGTCTCAGGG + Intronic
950461145 3:13122860-13122882 AAGTAGCCCCTGCAGTGGCAGGG - Intergenic
952455238 3:33466379-33466401 GAGAAGCCCCTGTACTCGCAGGG + Intergenic
952929334 3:38347175-38347197 GAGGAGCGCCTGCAGTTTCCTGG - Intronic
953885189 3:46711070-46711092 GAGGGGCAGCTGCAGTCACCTGG + Intergenic
954215468 3:49122011-49122033 GAGGAGGCCCAGCGGGCACAGGG - Exonic
955041700 3:55323813-55323835 GATGAACCCCTCCAGTCCCATGG + Intergenic
955047269 3:55372153-55372175 CAGGAGCCCCAGTAGACACAAGG + Intergenic
955223163 3:57039810-57039832 GAGGGGCCAGTGTAGTCACAAGG - Intronic
955867654 3:63402100-63402122 AAGGAGGCCCTGCAGCCAGAAGG + Intronic
962250519 3:133833387-133833409 CAGGTGCCCCAGCAGTCCCACGG - Intronic
964329451 3:155586310-155586332 GAGGAGCCCCTGCAATCCATAGG + Intronic
968040892 3:195588445-195588467 GAGGAGCCCCTGTGGTCATTTGG + Intergenic
968478610 4:824384-824406 GCAGCGCCCCTGCAGCCACACGG - Intronic
968957507 4:3726801-3726823 GAAGAACCGCTGGAGTCACATGG - Intergenic
969115745 4:4869698-4869720 GAGAAGCCCCTGCTGCCACCCGG - Intergenic
969411487 4:7031299-7031321 GAGGAGCCACTGCTGGCACAAGG - Exonic
969688586 4:8690718-8690740 CAAGAGCACCTGCAGCCACACGG - Intergenic
969725096 4:8914011-8914033 CAGGCTCCCCTGCAGGCACAAGG - Intergenic
969941567 4:10737087-10737109 GAAGAGCCCCTCCAGTGGCAGGG + Intergenic
970938809 4:21606956-21606978 GAGGAACCCATGAAATCACAAGG - Intronic
972475764 4:39447482-39447504 GCGGGGCCCCTTCAGACACAGGG + Intronic
975610564 4:76198586-76198608 GAGAAGCCCCAGCTGTAACATGG - Intronic
981460352 4:145006859-145006881 GAGGAGTCTCTGCAGAGACAAGG - Intronic
985609138 5:877021-877043 GTGTTGCCCCTGCAGCCACAAGG + Intronic
985881128 5:2640123-2640145 GCCGAGCCCCTACAGTCACCTGG + Intergenic
985960182 5:3296046-3296068 GAGGAACGCCTGCAGCCACCAGG + Intergenic
986103407 5:4635439-4635461 GAGACTCCCCTGCAGACACAGGG - Intergenic
988708758 5:33752813-33752835 GAGGAGCCCCCACAGTCAGGAGG + Intronic
991234188 5:64375352-64375374 GAGGAGGCCCTTAAGGCACAAGG + Intergenic
991441164 5:66650955-66650977 GAGGAGGAACTGCAGTCACATGG + Intronic
991583850 5:68182902-68182924 GAGGGGCCCCTGTGGTCCCAGGG + Intergenic
992963403 5:81977626-81977648 GAGGAGCTCCTGCAAAGACAGGG - Intronic
996613551 5:125412868-125412890 GAGGAGCCCTGACAGTCACGGGG - Intergenic
997193290 5:131959959-131959981 GTGTAGCCCCTTGAGTCACATGG - Intronic
997699166 5:135884389-135884411 CAGGGGACCCTGCAGTCCCAGGG - Intronic
999080291 5:148837127-148837149 GAGGACCCCCCGCAGCCACTTGG + Intergenic
1001628887 5:173160030-173160052 GAGGAGGCCATGCAGTCTCTAGG + Exonic
1006034761 6:31202601-31202623 GAGGAGCCCCTCCAGGCCCAGGG - Exonic
1010575515 6:77525361-77525383 GAGGAGGCCCTGCAAACACAAGG + Intergenic
1019192925 6:170263989-170264011 GCTGGGCCCCTGCAGTCACAAGG + Intergenic
1019661913 7:2229242-2229264 GAGGAGCCTGCGCAGCCACAGGG + Intronic
1019748793 7:2715971-2715993 CAGAAGCCCCTGCATTCACAAGG + Exonic
1028158078 7:87454898-87454920 GAGGAGCCACTGAAGAGACAAGG + Intronic
1031973624 7:128080555-128080577 CAGGACCTCCTGCTGTCACAGGG - Intronic
1032482200 7:132256167-132256189 CAGCAGCCCCTGCTGTGACAGGG + Intronic
1032953067 7:136938627-136938649 GAGGAGCTCATGCGGGCACAGGG + Intronic
1033122242 7:138676443-138676465 GAGGAACCACTGCGCTCACAGGG + Intronic
1034685072 7:152963378-152963400 GAGCAACCCATGCAGTCAGATGG + Intergenic
1035298559 7:157881607-157881629 GACGCATCCCTGCAGTCACAGGG - Intronic
1036207533 8:6815982-6816004 GGGGAGCCGCTGCAGACTCACGG - Intronic
1039839070 8:41280692-41280714 CAGCAGCTCCTGCAGCCACAGGG - Intronic
1048876043 8:138837673-138837695 GAGGAGCCCCAGCAGTGGGAGGG + Intronic
1049344555 8:142131598-142131620 GAGGAATCCCGGCAGTGACAGGG + Intergenic
1049767610 8:144362237-144362259 GAAGGGCCCCTGCAGCTACAGGG + Intergenic
1053150567 9:35740390-35740412 CAGGAGCCCCTTCAGCCCCAGGG + Intronic
1057355113 9:94325803-94325825 GAGGAACCACTGCAGTCACGAGG + Exonic
1057652639 9:96931831-96931853 GAGGAACCACTGCAGTCACGAGG - Exonic
1057968567 9:99530111-99530133 GAGGAGCCCCACCATTCAAAGGG - Intergenic
1059447184 9:114345805-114345827 GAGGAGCCCCCGCTGACACCAGG + Intronic
1060758919 9:126232669-126232691 GAGGAGGCCGAGCAGCCACATGG - Intergenic
1060789501 9:126476375-126476397 GAGGAGGGCCTGCAGACAAACGG + Intronic
1060810261 9:126607932-126607954 CAGGAGCCCCTGACGTCACAGGG + Intergenic
1061505125 9:131027382-131027404 TAGGAGCCCTTGGAGACACATGG - Intronic
1062163651 9:135094162-135094184 GAGTAGCTCCTGCAGCCACATGG - Intronic
1062173993 9:135150892-135150914 GTGGGTCCCATGCAGTCACAGGG - Intergenic
1062181870 9:135195267-135195289 CAGGAGCCACAGCAGGCACAGGG - Intergenic
1062469231 9:136695033-136695055 AAGGAGCCCCTGAAGGCAAAGGG - Intergenic
1186343212 X:8664704-8664726 GAGGAGAGCCTGCTGACACAAGG + Intronic
1194074301 X:89369387-89369409 GAGGTGCCCCTGAAGTCTCTGGG - Intergenic
1195704332 X:107728061-107728083 GATAAGCCCCTGCCCTCACAAGG - Intronic
1195907525 X:109859971-109859993 GAGGAGACCATGAAGACACAGGG + Intergenic
1199587820 X:149435018-149435040 GATGAGCCCCAAGAGTCACAGGG + Intergenic
1200003751 X:153074503-153074525 GAGGCGCCCCTCCAGTGCCAGGG + Exonic
1200375259 X:155773789-155773811 GAGGAGCCCTTGTAGTTACATGG - Exonic
1200729694 Y:6720914-6720936 GAGGTGCCCCTGAAGTCTCTGGG - Intergenic