ID: 1070867147

View in Genome Browser
Species Human (GRCh38)
Location 10:79713405-79713427
Sequence ATGTAGACACAGATTTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070867141_1070867147 27 Left 1070867141 10:79713355-79713377 CCACAGCTATGATTCCCTTCCCA 0: 5
1: 0
2: 1
3: 19
4: 207
Right 1070867147 10:79713405-79713427 ATGTAGACACAGATTTACATTGG No data
1070867144_1070867147 8 Left 1070867144 10:79713374-79713396 CCCATATGATGACTGAACTCATG 0: 5
1: 2
2: 0
3: 8
4: 101
Right 1070867147 10:79713405-79713427 ATGTAGACACAGATTTACATTGG No data
1070867139_1070867147 29 Left 1070867139 10:79713353-79713375 CCCCACAGCTATGATTCCCTTCC 0: 5
1: 2
2: 2
3: 11
4: 202
Right 1070867147 10:79713405-79713427 ATGTAGACACAGATTTACATTGG No data
1070867138_1070867147 30 Left 1070867138 10:79713352-79713374 CCCCCACAGCTATGATTCCCTTC 0: 5
1: 2
2: 0
3: 11
4: 160
Right 1070867147 10:79713405-79713427 ATGTAGACACAGATTTACATTGG No data
1070867143_1070867147 12 Left 1070867143 10:79713370-79713392 CCTTCCCATATGATGACTGAACT 0: 7
1: 0
2: 1
3: 4
4: 117
Right 1070867147 10:79713405-79713427 ATGTAGACACAGATTTACATTGG No data
1070867142_1070867147 13 Left 1070867142 10:79713369-79713391 CCCTTCCCATATGATGACTGAAC 0: 7
1: 0
2: 0
3: 5
4: 124
Right 1070867147 10:79713405-79713427 ATGTAGACACAGATTTACATTGG No data
1070867140_1070867147 28 Left 1070867140 10:79713354-79713376 CCCACAGCTATGATTCCCTTCCC 0: 7
1: 0
2: 2
3: 19
4: 168
Right 1070867147 10:79713405-79713427 ATGTAGACACAGATTTACATTGG No data
1070867145_1070867147 7 Left 1070867145 10:79713375-79713397 CCATATGATGACTGAACTCATGT 0: 5
1: 2
2: 0
3: 12
4: 189
Right 1070867147 10:79713405-79713427 ATGTAGACACAGATTTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070867147 Original CRISPR ATGTAGACACAGATTTACAT TGG Intronic
No off target data available for this crispr