ID: 1070870294

View in Genome Browser
Species Human (GRCh38)
Location 10:79745369-79745391
Sequence CACAGCAAGGAGAATGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070870294_1070870299 24 Left 1070870294 10:79745369-79745391 CCTGCCACATTCTCCTTGCTGTG No data
Right 1070870299 10:79745416-79745438 TACTAAGGGAACTCAGAGACCGG No data
1070870294_1070870297 9 Left 1070870294 10:79745369-79745391 CCTGCCACATTCTCCTTGCTGTG No data
Right 1070870297 10:79745401-79745423 ATAGTAATCAATAAATACTAAGG No data
1070870294_1070870298 10 Left 1070870294 10:79745369-79745391 CCTGCCACATTCTCCTTGCTGTG No data
Right 1070870298 10:79745402-79745424 TAGTAATCAATAAATACTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070870294 Original CRISPR CACAGCAAGGAGAATGTGGC AGG (reversed) Intergenic
No off target data available for this crispr