ID: 1070878421

View in Genome Browser
Species Human (GRCh38)
Location 10:79838619-79838641
Sequence TTTCCTAGTGGGGGCCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070878421_1070878427 12 Left 1070878421 10:79838619-79838641 CCCGCAGGGCCCCCACTAGGAAA No data
Right 1070878427 10:79838654-79838676 TCCGCCTTGAGCACAGCCACAGG No data
1070878421_1070878430 22 Left 1070878421 10:79838619-79838641 CCCGCAGGGCCCCCACTAGGAAA No data
Right 1070878430 10:79838664-79838686 GCACAGCCACAGGCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070878421 Original CRISPR TTTCCTAGTGGGGGCCCTGC GGG (reversed) Intergenic
No off target data available for this crispr