ID: 1070878427

View in Genome Browser
Species Human (GRCh38)
Location 10:79838654-79838676
Sequence TCCGCCTTGAGCACAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070878419_1070878427 21 Left 1070878419 10:79838610-79838632 CCTGGGCATCCCGCAGGGCCCCC No data
Right 1070878427 10:79838654-79838676 TCCGCCTTGAGCACAGCCACAGG No data
1070878425_1070878427 1 Left 1070878425 10:79838630-79838652 CCCACTAGGAAAGCTATGAACGC No data
Right 1070878427 10:79838654-79838676 TCCGCCTTGAGCACAGCCACAGG No data
1070878422_1070878427 11 Left 1070878422 10:79838620-79838642 CCGCAGGGCCCCCACTAGGAAAG No data
Right 1070878427 10:79838654-79838676 TCCGCCTTGAGCACAGCCACAGG No data
1070878426_1070878427 0 Left 1070878426 10:79838631-79838653 CCACTAGGAAAGCTATGAACGCT No data
Right 1070878427 10:79838654-79838676 TCCGCCTTGAGCACAGCCACAGG No data
1070878423_1070878427 3 Left 1070878423 10:79838628-79838650 CCCCCACTAGGAAAGCTATGAAC No data
Right 1070878427 10:79838654-79838676 TCCGCCTTGAGCACAGCCACAGG No data
1070878421_1070878427 12 Left 1070878421 10:79838619-79838641 CCCGCAGGGCCCCCACTAGGAAA No data
Right 1070878427 10:79838654-79838676 TCCGCCTTGAGCACAGCCACAGG No data
1070878424_1070878427 2 Left 1070878424 10:79838629-79838651 CCCCACTAGGAAAGCTATGAACG No data
Right 1070878427 10:79838654-79838676 TCCGCCTTGAGCACAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070878427 Original CRISPR TCCGCCTTGAGCACAGCCAC AGG Intergenic
No off target data available for this crispr