ID: 1070878497

View in Genome Browser
Species Human (GRCh38)
Location 10:79838969-79838991
Sequence TCTCCAGCGGGGCCCTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070878497_1070878507 5 Left 1070878497 10:79838969-79838991 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1070878507 10:79838997-79839019 AAATGGAGGGACGCGGCACCTGG No data
1070878497_1070878509 16 Left 1070878497 10:79838969-79838991 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1070878509 10:79839008-79839030 CGCGGCACCTGGGTGCTTCCTGG No data
1070878497_1070878511 18 Left 1070878497 10:79838969-79838991 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1070878511 10:79839010-79839032 CGGCACCTGGGTGCTTCCTGGGG No data
1070878497_1070878508 6 Left 1070878497 10:79838969-79838991 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1070878508 10:79838998-79839020 AATGGAGGGACGCGGCACCTGGG No data
1070878497_1070878510 17 Left 1070878497 10:79838969-79838991 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1070878510 10:79839009-79839031 GCGGCACCTGGGTGCTTCCTGGG No data
1070878497_1070878505 -8 Left 1070878497 10:79838969-79838991 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1070878505 10:79838984-79839006 GCTGGAGATGTGGAAATGGAGGG No data
1070878497_1070878504 -9 Left 1070878497 10:79838969-79838991 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1070878504 10:79838983-79839005 CGCTGGAGATGTGGAAATGGAGG No data
1070878497_1070878506 -2 Left 1070878497 10:79838969-79838991 CCCTAGGAGGGCCCCGCTGGAGA No data
Right 1070878506 10:79838990-79839012 GATGTGGAAATGGAGGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070878497 Original CRISPR TCTCCAGCGGGGCCCTCCTA GGG (reversed) Intergenic
No off target data available for this crispr