ID: 1070883055

View in Genome Browser
Species Human (GRCh38)
Location 10:79866079-79866101
Sequence TCTGCTCCAAATGAATACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070883047_1070883055 21 Left 1070883047 10:79866035-79866057 CCCAGCAACTTCCAGATGTTGAG No data
Right 1070883055 10:79866079-79866101 TCTGCTCCAAATGAATACCCTGG No data
1070883045_1070883055 27 Left 1070883045 10:79866029-79866051 CCATGCCCCAGCAACTTCCAGAT No data
Right 1070883055 10:79866079-79866101 TCTGCTCCAAATGAATACCCTGG No data
1070883046_1070883055 22 Left 1070883046 10:79866034-79866056 CCCCAGCAACTTCCAGATGTTGA No data
Right 1070883055 10:79866079-79866101 TCTGCTCCAAATGAATACCCTGG No data
1070883044_1070883055 28 Left 1070883044 10:79866028-79866050 CCCATGCCCCAGCAACTTCCAGA No data
Right 1070883055 10:79866079-79866101 TCTGCTCCAAATGAATACCCTGG No data
1070883052_1070883055 10 Left 1070883052 10:79866046-79866068 CCAGATGTTGAGTTGGGACAGGG No data
Right 1070883055 10:79866079-79866101 TCTGCTCCAAATGAATACCCTGG No data
1070883048_1070883055 20 Left 1070883048 10:79866036-79866058 CCAGCAACTTCCAGATGTTGAGT No data
Right 1070883055 10:79866079-79866101 TCTGCTCCAAATGAATACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070883055 Original CRISPR TCTGCTCCAAATGAATACCC TGG Intergenic
No off target data available for this crispr