ID: 1070884256

View in Genome Browser
Species Human (GRCh38)
Location 10:79875370-79875392
Sequence GTGGACTAAACAGGAACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070884256_1070884262 -2 Left 1070884256 10:79875370-79875392 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1070884262 10:79875391-79875413 ACAGCAAAGGTGCGGCCGGTTGG No data
1070884256_1070884259 -10 Left 1070884256 10:79875370-79875392 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1070884259 10:79875383-79875405 TTTAGTCCACAGCAAAGGTGCGG No data
1070884256_1070884260 -6 Left 1070884256 10:79875370-79875392 CCAGTGGTTCCTGTTTAGTCCAC No data
Right 1070884260 10:79875387-79875409 GTCCACAGCAAAGGTGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070884256 Original CRISPR GTGGACTAAACAGGAACCAC TGG (reversed) Intergenic
No off target data available for this crispr