ID: 1070884334

View in Genome Browser
Species Human (GRCh38)
Location 10:79875833-79875855
Sequence GACCCTAGGAGGGTGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070884324_1070884334 10 Left 1070884324 10:79875800-79875822 CCCTCAAAACACATGATGAGATG No data
Right 1070884334 10:79875833-79875855 GACCCTAGGAGGGTGGGGACTGG No data
1070884325_1070884334 9 Left 1070884325 10:79875801-79875823 CCTCAAAACACATGATGAGATGG No data
Right 1070884334 10:79875833-79875855 GACCCTAGGAGGGTGGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070884334 Original CRISPR GACCCTAGGAGGGTGGGGAC TGG Intergenic
No off target data available for this crispr