ID: 1070885222

View in Genome Browser
Species Human (GRCh38)
Location 10:79889407-79889429
Sequence CAGTTTAACCTCAGGGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070885222_1070885226 7 Left 1070885222 10:79889407-79889429 CCGTTTTCCCTGAGGTTAAACTG No data
Right 1070885226 10:79889437-79889459 CTCTTTCTGTTGTAGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070885222 Original CRISPR CAGTTTAACCTCAGGGAAAA CGG (reversed) Intergenic
No off target data available for this crispr