ID: 1070896383

View in Genome Browser
Species Human (GRCh38)
Location 10:79986104-79986126
Sequence CGATGTACATACAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070896378_1070896383 6 Left 1070896378 10:79986075-79986097 CCTGCTCAGTGCAGAAGGGTCCT No data
Right 1070896383 10:79986104-79986126 CGATGTACATACAAGGAGGTGGG No data
1070896374_1070896383 28 Left 1070896374 10:79986053-79986075 CCTAGTGCTAACACAGCTCAGCC No data
Right 1070896383 10:79986104-79986126 CGATGTACATACAAGGAGGTGGG No data
1070896377_1070896383 7 Left 1070896377 10:79986074-79986096 CCCTGCTCAGTGCAGAAGGGTCC No data
Right 1070896383 10:79986104-79986126 CGATGTACATACAAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070896383 Original CRISPR CGATGTACATACAAGGAGGT GGG Intergenic
No off target data available for this crispr