ID: 1070900337

View in Genome Browser
Species Human (GRCh38)
Location 10:80022806-80022828
Sequence CTGTCAGTGTGGATGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070900329_1070900337 21 Left 1070900329 10:80022762-80022784 CCTGGATGCAGACAGCTGAGAAC No data
Right 1070900337 10:80022806-80022828 CTGTCAGTGTGGATGCCAGAGGG No data
1070900328_1070900337 25 Left 1070900328 10:80022758-80022780 CCAACCTGGATGCAGACAGCTGA No data
Right 1070900337 10:80022806-80022828 CTGTCAGTGTGGATGCCAGAGGG No data
1070900332_1070900337 -5 Left 1070900332 10:80022788-80022810 CCTAGCCTGCTGGGCCTGCTGTC No data
Right 1070900337 10:80022806-80022828 CTGTCAGTGTGGATGCCAGAGGG No data
1070900333_1070900337 -10 Left 1070900333 10:80022793-80022815 CCTGCTGGGCCTGCTGTCAGTGT No data
Right 1070900337 10:80022806-80022828 CTGTCAGTGTGGATGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070900337 Original CRISPR CTGTCAGTGTGGATGCCAGA GGG Intergenic
No off target data available for this crispr