ID: 1070906313

View in Genome Browser
Species Human (GRCh38)
Location 10:80076514-80076536
Sequence CAGGGTAGCCTTGGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070906307_1070906313 17 Left 1070906307 10:80076474-80076496 CCATCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1070906313 10:80076514-80076536 CAGGGTAGCCTTGGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070906313 Original CRISPR CAGGGTAGCCTTGGTGAGGA TGG Intergenic
No off target data available for this crispr