ID: 1070907500

View in Genome Browser
Species Human (GRCh38)
Location 10:80086289-80086311
Sequence AACCCGGAGAAGGGTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070907500_1070907508 11 Left 1070907500 10:80086289-80086311 CCAGGAAAACCCTTCTCCGGGTT No data
Right 1070907508 10:80086323-80086345 AACTGTGACCCTTCTGAAGGAGG 0: 1
1: 0
2: 7
3: 14
4: 151
1070907500_1070907509 14 Left 1070907500 10:80086289-80086311 CCAGGAAAACCCTTCTCCGGGTT No data
Right 1070907509 10:80086326-80086348 TGTGACCCTTCTGAAGGAGGAGG 0: 1
1: 4
2: 0
3: 20
4: 224
1070907500_1070907506 8 Left 1070907500 10:80086289-80086311 CCAGGAAAACCCTTCTCCGGGTT No data
Right 1070907506 10:80086320-80086342 ACCAACTGTGACCCTTCTGAAGG 0: 1
1: 0
2: 2
3: 24
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070907500 Original CRISPR AACCCGGAGAAGGGTTTTCC TGG (reversed) Intronic