ID: 1070909771

View in Genome Browser
Species Human (GRCh38)
Location 10:80107845-80107867
Sequence CTGAATGCAAAGATGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070909762_1070909771 21 Left 1070909762 10:80107801-80107823 CCATGGACCAGGTTCCCCCAGTA No data
Right 1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG No data
1070909760_1070909771 26 Left 1070909760 10:80107796-80107818 CCCAACCATGGACCAGGTTCCCC No data
Right 1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG No data
1070909767_1070909771 4 Left 1070909767 10:80107818-80107840 CCAGTACGAGCCATGAGCCAGTT No data
Right 1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG No data
1070909768_1070909771 -6 Left 1070909768 10:80107828-80107850 CCATGAGCCAGTTGAATCTGAAT 0: 23
1: 22
2: 8
3: 28
4: 218
Right 1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG No data
1070909763_1070909771 14 Left 1070909763 10:80107808-80107830 CCAGGTTCCCCCAGTACGAGCCA No data
Right 1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG No data
1070909765_1070909771 6 Left 1070909765 10:80107816-80107838 CCCCAGTACGAGCCATGAGCCAG 0: 7
1: 18
2: 15
3: 85
4: 344
Right 1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG No data
1070909766_1070909771 5 Left 1070909766 10:80107817-80107839 CCCAGTACGAGCCATGAGCCAGT No data
Right 1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG No data
1070909761_1070909771 25 Left 1070909761 10:80107797-80107819 CCAACCATGGACCAGGTTCCCCC No data
Right 1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG No data
1070909764_1070909771 7 Left 1070909764 10:80107815-80107837 CCCCCAGTACGAGCCATGAGCCA No data
Right 1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070909771 Original CRISPR CTGAATGCAAAGATGGAATG AGG Intergenic
No off target data available for this crispr