ID: 1070911957

View in Genome Browser
Species Human (GRCh38)
Location 10:80126831-80126853
Sequence CATTCTGCACAGATGAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070911957_1070911968 30 Left 1070911957 10:80126831-80126853 CCCCTCTTCATCTGTGCAGAATG No data
Right 1070911968 10:80126884-80126906 TCTCCCGGCGTGGGTCTTTCTGG No data
1070911957_1070911967 21 Left 1070911957 10:80126831-80126853 CCCCTCTTCATCTGTGCAGAATG No data
Right 1070911967 10:80126875-80126897 ACTGAGAGCTCTCCCGGCGTGGG No data
1070911957_1070911965 15 Left 1070911957 10:80126831-80126853 CCCCTCTTCATCTGTGCAGAATG No data
Right 1070911965 10:80126869-80126891 GTGCTCACTGAGAGCTCTCCCGG No data
1070911957_1070911966 20 Left 1070911957 10:80126831-80126853 CCCCTCTTCATCTGTGCAGAATG No data
Right 1070911966 10:80126874-80126896 CACTGAGAGCTCTCCCGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070911957 Original CRISPR CATTCTGCACAGATGAAGAG GGG (reversed) Intergenic
No off target data available for this crispr