ID: 1070913580

View in Genome Browser
Species Human (GRCh38)
Location 10:80138401-80138423
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070913580_1070913586 28 Left 1070913580 10:80138401-80138423 CCCAGATTCAGCAATAACACCAT 0: 2
1: 0
2: 0
3: 12
4: 144
Right 1070913586 10:80138452-80138474 AGTGGAGGGAAATAATGAAAAGG No data
1070913580_1070913584 13 Left 1070913580 10:80138401-80138423 CCCAGATTCAGCAATAACACCAT 0: 2
1: 0
2: 0
3: 12
4: 144
Right 1070913584 10:80138437-80138459 GTATTTTCTAAGTTCAGTGGAGG No data
1070913580_1070913585 14 Left 1070913580 10:80138401-80138423 CCCAGATTCAGCAATAACACCAT 0: 2
1: 0
2: 0
3: 12
4: 144
Right 1070913585 10:80138438-80138460 TATTTTCTAAGTTCAGTGGAGGG No data
1070913580_1070913583 10 Left 1070913580 10:80138401-80138423 CCCAGATTCAGCAATAACACCAT 0: 2
1: 0
2: 0
3: 12
4: 144
Right 1070913583 10:80138434-80138456 AGAGTATTTTCTAAGTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070913580 Original CRISPR ATGGTGTTATTGCTGAATCT GGG (reversed) Intronic
906889270 1:49690020-49690042 AGGGTGCTATTGCTGAAGGTTGG - Intronic
908305952 1:62816138-62816160 AAGGTGTTTTTGCTGCATATAGG + Intronic
909391529 1:75126555-75126577 AGGGTGTTATTACTGAAAGTTGG + Intergenic
911780523 1:101870290-101870312 ATGATGTTATTGATGAATTATGG - Intronic
912949553 1:114111429-114111451 ATGGTGTCATGGCTGAAAGTGGG - Intronic
916188810 1:162159366-162159388 CTAGTGCTATTGTTGAATCTGGG + Intronic
917000231 1:170349700-170349722 CTAGTGTTTTTGCTGAAGCTAGG - Intergenic
920552513 1:206874640-206874662 TTGTTGTTATTGCTGAGACTGGG - Intergenic
921796566 1:219351633-219351655 AAGAAGTTGTTGCTGAATCTGGG + Intergenic
1065612490 10:27485976-27485998 ATGGTGGTGTTGGTGACTCTGGG - Intergenic
1069260861 10:66394649-66394671 ATGGTTTTATTGCATAATATGGG - Intronic
1070005901 10:72423726-72423748 ATCGGGATATTGCTGAGTCTGGG - Intronic
1070427433 10:76303244-76303266 ATCGTGTTTTTGATGAGTCTTGG + Intronic
1070913580 10:80138401-80138423 ATGGTGTTATTGCTGAATCTGGG - Intronic
1072958307 10:99906371-99906393 ATGGTGTCATGGCTGGAACTGGG + Intronic
1080441508 11:32298949-32298971 ATGCTGTGATTGCTGACTTTAGG - Intergenic
1080950623 11:37028487-37028509 ATGGTTTTATTTCTGCCTCTAGG + Intergenic
1082967765 11:58985257-58985279 GTGGTGTTATTCCTGAGGCTAGG + Intronic
1083112260 11:60422880-60422902 ATAGGTTTATTGCTGAATTTTGG - Intergenic
1084451738 11:69243040-69243062 ATGATGGCATTGCTGGATCTGGG + Intergenic
1086410045 11:86536046-86536068 ATAGAGATATAGCTGAATCTAGG - Intronic
1088071962 11:105798016-105798038 GTGTTATTATTGCTGAATCTAGG - Intronic
1089507066 11:118970960-118970982 TTGGTGTAATTGGTCAATCTGGG + Intergenic
1089889312 11:121864488-121864510 ATATTGTTTTTGCAGAATCTAGG + Intergenic
1092403875 12:8202213-8202235 ATGGTGGTACTACTGACTCTTGG + Intergenic
1102143808 12:110638790-110638812 CCGGTGTCATTGCTGAATCAGGG + Intronic
1105636315 13:22219003-22219025 CTGGAGTCACTGCTGAATCTTGG + Intergenic
1107456767 13:40562733-40562755 CTGGTGTTTCTGCTGAAACTTGG - Intronic
1109988628 13:70023536-70023558 ATGTTGTTATTTTTTAATCTAGG + Intronic
1110368473 13:74714632-74714654 ATGCTGTTATTCATGACTCTAGG - Intergenic
1111416292 13:87949708-87949730 ATGGTTTTATTACTGATTCTAGG - Intergenic
1112661445 13:101513307-101513329 AAGGTGATATTGATGAGTCTGGG + Intronic
1115812222 14:37121948-37121970 ATGGGTTTATTGCTGTCTCTGGG - Intronic
1119098343 14:71855327-71855349 ATGTTGATAATGATGAATCTGGG + Intergenic
1119638515 14:76296100-76296122 ATGGCGTTCTTGCTGAGTTTGGG - Intergenic
1120043751 14:79782916-79782938 AAGGAGTTATTCCTGAATCCAGG - Intronic
1122054752 14:99087227-99087249 ATTATGTGATTTCTGAATCTTGG - Intergenic
1124398936 15:29331635-29331657 ATGCTGTCATTGCTGAATATCGG - Intronic
1127616636 15:60692648-60692670 ATGTTGGTAAGGCTGAATCTGGG + Intronic
1128394217 15:67207271-67207293 ATGGTGGTATTGTTGCTTCTAGG + Intronic
1131088712 15:89601623-89601645 ATGGTGTTGTCTCTGAATTTTGG + Intronic
1131256639 15:90867194-90867216 TTGGTGATAATGCTGAATCAAGG - Intergenic
1137667198 16:50258347-50258369 GTGGTGTTTTTGTTGAAGCTGGG + Intronic
1138716322 16:59027321-59027343 CTTGTGTTATTGCTGAAACATGG - Intergenic
1141336711 16:83162833-83162855 ATGGTGTTATAGCTGGATTGGGG + Intronic
1142819346 17:2452704-2452726 AAGATGTAATTGGTGAATCTGGG - Intronic
1156212815 18:34964818-34964840 ATGGTGATATTCCTGATTATAGG - Intergenic
1156707338 18:39899373-39899395 ATGGTGATAGTGTTGATTCTGGG + Intergenic
1163714838 19:18867643-18867665 ATGGGGTGATTGCTGCTTCTGGG + Exonic
1164328073 19:24219780-24219802 ATGCTGTTTTTGTAGAATCTAGG - Intergenic
1167198656 19:48048751-48048773 AAGCTGTTATTGCTGGATCAGGG - Intronic
929846402 2:45533401-45533423 ATGGTGTTCTTGGTGAAGTTAGG - Intronic
930396774 2:50831520-50831542 CTGGTGTTATTCTTGCATCTGGG + Intronic
932861328 2:75295391-75295413 ATTTAGTTATTGCTGCATCTGGG - Intergenic
933571135 2:84014148-84014170 TTGTTGTTATTGCTGTATGTTGG - Intergenic
938265985 2:129928640-129928662 ATGGTGTTATTGCTGAATCTGGG + Intergenic
939858230 2:147386710-147386732 ATGTTGTTATCTCTGGATCTTGG - Intergenic
940398344 2:153219828-153219850 GCTGAGTTATTGCTGAATCTGGG + Intergenic
943531777 2:189091435-189091457 AGGGTGGTATTGCTGAAGCCTGG - Intronic
946096575 2:217279602-217279624 ATGCTTTTGTTGCTGGATCTTGG - Intergenic
948559670 2:238843668-238843690 CTGGTGTCATTGCTGAAGTTAGG + Intergenic
1169583817 20:7058115-7058137 TTGGAGTTAATGCTGAAACTTGG - Intergenic
1169804296 20:9543626-9543648 ATGGTGTGGATGGTGAATCTGGG - Intronic
1170257604 20:14362581-14362603 ATGGTTTAATTGCTCTATCTAGG + Intronic
1170322995 20:15121816-15121838 ATGGTGAAATTTCTGAAACTAGG + Intronic
1172358558 20:34296326-34296348 ATTGGGTAACTGCTGAATCTGGG + Intronic
1173153984 20:40592445-40592467 ATGTTGTGATTGATGAATGTAGG + Intergenic
1174833854 20:53837978-53838000 ATAGTGTTATGGTTGAGTCTGGG + Intergenic
1176102210 20:63369727-63369749 ATGTTGTTATCCCTGGATCTGGG + Intronic
1178285788 21:31324205-31324227 ATTGAGTTATTGTTGAATGTTGG - Intronic
1178948601 21:36967409-36967431 ATGGTGTTCTTGCTACATGTGGG + Intronic
1183222434 22:36524568-36524590 ATGGTGTGGTTGCTGGCTCTTGG + Intronic
950730158 3:14948981-14949003 ATGGTGTTATTGTTAAAAATGGG + Intronic
951629328 3:24701918-24701940 AGGATGTTTTTGCTGAATATAGG + Intergenic
951697499 3:25461082-25461104 CTAGTGTTATTGCTGAATTTGGG + Intronic
951753412 3:26061961-26061983 ATGGTTTTATTGCTGCCTCTGGG + Intergenic
954416055 3:50393952-50393974 CTGGAGTAATTGCTGAATGTTGG + Intronic
956435035 3:69226576-69226598 ATGTTGTTATTTCTGGATCCAGG + Intronic
957947208 3:87080326-87080348 TTGTTGATATTGCTGAATTTTGG + Intergenic
959133775 3:102391467-102391489 ATGATGTGATTTCTGAATCTCGG + Intronic
961931093 3:130533523-130533545 AAGATGTTATTGTTAAATCTGGG - Intergenic
963489577 3:145982750-145982772 TTTGAGTTATTTCTGAATCTGGG + Intergenic
965670763 3:171145436-171145458 GTGGTGGGATTGCTGGATCTGGG + Intronic
966174851 3:177126969-177126991 ATGTTGTTTTTGCTGAAACTGGG - Intronic
967271483 3:187737008-187737030 TTGGTGGAATGGCTGAATCTAGG - Intronic
967684809 3:192407830-192407852 AGAGTGTTTTTGCTGAATATGGG + Intronic
967706548 3:192657765-192657787 ATGGTTTTATTGATAAATTTGGG - Intronic
969815376 4:9683237-9683259 ATGGGGTTACTGTTGAATGTTGG + Intergenic
971092205 4:23359101-23359123 GTGTTGTTATTGCTGAACCAGGG + Intergenic
973175611 4:47201613-47201635 AAGGTGCTATTTCTTAATCTGGG + Intronic
980838523 4:138228259-138228281 ATGGTGTTAGGGATGGATCTGGG + Intronic
981726661 4:147854852-147854874 ATGTTGTTATTGTTGTTTCTTGG + Intronic
981990909 4:150919510-150919532 ATAGTGTTATTACTGAAGTTTGG - Intronic
982254293 4:153437051-153437073 ACTGTGTTATTGATAAATCTTGG - Intergenic
983919005 4:173325214-173325236 ATGGTGGTATTGCTGAACTGAGG + Intergenic
984194593 4:176643121-176643143 ATTGTGTTTTTACTGTATCTTGG - Intergenic
991303564 5:65152462-65152484 CTAGTGTAGTTGCTGAATCTAGG - Intronic
992203547 5:74407463-74407485 CTTGTGTTATTGCGGCATCTTGG + Intergenic
995271530 5:110225248-110225270 ATTGTGTTATTTCTGAGCCTAGG + Intergenic
995397358 5:111701447-111701469 ATGGTTCTATTTCTGAATTTAGG + Intronic
995856390 5:116597342-116597364 ATGGTGATATTGCTGACCCAGGG + Intergenic
996883930 5:128333337-128333359 ATGGTGTTGTGTCTGAATCTGGG - Intronic
996914568 5:128696882-128696904 ATGCTGATATTGTTGAATTTGGG + Intronic
998380668 5:141722949-141722971 AGGGTCTTATTGCAGAATCTGGG + Intergenic
1000722661 5:164727726-164727748 AGGGTTTTATTGCTTAATTTAGG + Intergenic
1006226941 6:32547480-32547502 ATGTTGCTACTGCTGACTCTGGG - Intergenic
1008489413 6:52070167-52070189 ATGGTGGTGTTGCAGAATTTTGG - Intronic
1009813781 6:68704211-68704233 ATGATGTTATTGAAGCATCTAGG + Intronic
1011143407 6:84186137-84186159 ATGGTGGTATTTTTGAATTTGGG + Intronic
1012945137 6:105457730-105457752 ATGATGATATTCATGAATCTTGG - Intergenic
1014046471 6:116893773-116893795 TTGTTGTTATTTCTGACTCTAGG - Intronic
1015611076 6:135019818-135019840 ATGGAGTTATTTCTGGATATTGG - Intronic
1017328136 6:153163884-153163906 ATCATGATATTGCTGAATTTTGG + Intergenic
1017332158 6:153212316-153212338 ATGATGTTTTTGCTGCAGCTTGG - Intergenic
1017475567 6:154787957-154787979 ATGATGTTATTACTAAATCTGGG - Exonic
1019877912 7:3831579-3831601 ATGGTATTTTTGCTGAGTGTAGG + Intronic
1020901786 7:14012611-14012633 ATGGTATTTGAGCTGAATCTTGG + Intergenic
1021509940 7:21424786-21424808 ATGGGGTTATTGCTGAAGGCAGG + Intergenic
1021538513 7:21731480-21731502 ATGCTGATATTGGTGTATCTAGG - Intronic
1022407289 7:30102617-30102639 ATGCTGATATGGATGAATCTTGG + Intronic
1023578659 7:41657757-41657779 ATGGTGCCATTCCTGAAACTGGG + Intergenic
1023778824 7:43636669-43636691 AAGGTTTTATTGCTGAGTTTTGG - Intronic
1026111996 7:67465764-67465786 ATGGTGTTGTTGCAGAATACTGG + Intergenic
1026129266 7:67606776-67606798 ATGTTCTTATTTCTGAACCTGGG + Intergenic
1028254156 7:88571582-88571604 ATGGGGGTAGTGCTGAACCTAGG + Intergenic
1028478993 7:91283942-91283964 ATGGTGATATTTTAGAATCTTGG - Intergenic
1031690264 7:124779452-124779474 ATGGTGTTCTTGCTCAATTTAGG + Intronic
1032581588 7:133108037-133108059 ATGTTGCTATTTCTGAAACTGGG - Intergenic
1036272269 8:7317300-7317322 ATGGTGGTACTACTGACTCTTGG - Intergenic
1036349079 8:7993042-7993064 ATGGTGGTACTACTGACTCTTGG + Intergenic
1036844352 8:12153515-12153537 ATGGTGGTACTACTGACTCTTGG + Intergenic
1036865724 8:12395837-12395859 ATGGTGGTACTACTGACTCTTGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1042156112 8:65845807-65845829 TTGTTGTTATTGCTGAAAATTGG + Intergenic
1043341124 8:79240952-79240974 ATGGTGTTATTTATGAAAATGGG + Intergenic
1044044031 8:87407389-87407411 ATGATGTTATTGATGGATATTGG + Intronic
1044498542 8:92922029-92922051 ATGGTATTATTGCAATATCTAGG + Intronic
1045025345 8:98081546-98081568 ATAGTGTTATTACTGAACCAGGG - Intronic
1048560645 8:135533399-135533421 GTAGTGTTAATGATGAATCTTGG + Intronic
1050565685 9:6880424-6880446 ACGGTATTGTTGCTGCATCTTGG + Intronic
1052727334 9:32244995-32245017 CAGGTGTTTATGCTGAATCTGGG - Intergenic
1056202895 9:84293878-84293900 ATGATGTTATTCCTTCATCTTGG - Intronic
1059054450 9:110964553-110964575 AAAATGTTATTACTGAATCTAGG + Intronic
1059505486 9:114795861-114795883 ATTGTGTCATTGCTGAGTCTAGG + Intronic
1060461297 9:123857065-123857087 ATGGTGGTGTTGCTGCTTCTAGG - Intronic
1061683310 9:132255177-132255199 GTGGTGAGATTGGTGAATCTGGG + Intergenic
1187302501 X:18064673-18064695 ATGGTCTGATTTCTGAGTCTAGG - Intergenic
1188153303 X:26707102-26707124 ATTGTTTTATTGCTAAATCAGGG + Intergenic
1191729927 X:64322669-64322691 ATGCAGTTATTGCTGGCTCTTGG - Intronic
1193882634 X:86943010-86943032 ATGGTCCTAGTACTGAATCTTGG - Intergenic
1194406355 X:93500677-93500699 TTGTTGTTATTGTTGTATCTTGG - Intergenic
1194416317 X:93616701-93616723 ATTGTCTTATTGTTGAACCTGGG + Intergenic
1195642365 X:107190559-107190581 TTAGTGTTATTGATGAATATAGG - Intronic
1196201041 X:112886275-112886297 ATGCTGTTTTTGCTGACTCAAGG - Intergenic
1196603308 X:117626520-117626542 ATGGTTTTAATGCAGAGTCTGGG - Intergenic
1196793805 X:119486979-119487001 ATCCTGTTATTGCTTACTCTGGG - Intergenic
1199514901 X:148665211-148665233 ATGAAGTCATTTCTGAATCTGGG - Intronic
1200837416 Y:7746421-7746443 ATGGTGTAGTTACTGAATATTGG - Intergenic