ID: 1070913610

View in Genome Browser
Species Human (GRCh38)
Location 10:80138641-80138663
Sequence GGTCAGGGTGCCTGAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070913601_1070913610 4 Left 1070913601 10:80138614-80138636 CCCCACCTTGCTGAGATGAGAAC 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1070913610 10:80138641-80138663 GGTCAGGGTGCCTGAGGTCCAGG No data
1070913602_1070913610 3 Left 1070913602 10:80138615-80138637 CCCACCTTGCTGAGATGAGAACA 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1070913610 10:80138641-80138663 GGTCAGGGTGCCTGAGGTCCAGG No data
1070913603_1070913610 2 Left 1070913603 10:80138616-80138638 CCACCTTGCTGAGATGAGAACAG 0: 1
1: 0
2: 2
3: 24
4: 239
Right 1070913610 10:80138641-80138663 GGTCAGGGTGCCTGAGGTCCAGG No data
1070913605_1070913610 -1 Left 1070913605 10:80138619-80138641 CCTTGCTGAGATGAGAACAGGAG 0: 1
1: 0
2: 3
3: 20
4: 248
Right 1070913610 10:80138641-80138663 GGTCAGGGTGCCTGAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070913610 Original CRISPR GGTCAGGGTGCCTGAGGTCC AGG Intronic
No off target data available for this crispr