ID: 1070916582

View in Genome Browser
Species Human (GRCh38)
Location 10:80158914-80158936
Sequence GTTCAACTGCACAGGGAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070916571_1070916582 26 Left 1070916571 10:80158865-80158887 CCAGAGCTGCACCGCAAACACAC 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1070916582 10:80158914-80158936 GTTCAACTGCACAGGGAACCGGG 0: 1
1: 0
2: 0
3: 6
4: 136
1070916572_1070916582 15 Left 1070916572 10:80158876-80158898 CCGCAAACACACACAAGACACCT 0: 1
1: 0
2: 4
3: 61
4: 617
Right 1070916582 10:80158914-80158936 GTTCAACTGCACAGGGAACCGGG 0: 1
1: 0
2: 0
3: 6
4: 136
1070916578_1070916582 -8 Left 1070916578 10:80158899-80158921 CCAGGACAGCTAGGGGTTCAACT 0: 1
1: 0
2: 0
3: 11
4: 66
Right 1070916582 10:80158914-80158936 GTTCAACTGCACAGGGAACCGGG 0: 1
1: 0
2: 0
3: 6
4: 136
1070916577_1070916582 -5 Left 1070916577 10:80158896-80158918 CCTCCAGGACAGCTAGGGGTTCA 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1070916582 10:80158914-80158936 GTTCAACTGCACAGGGAACCGGG 0: 1
1: 0
2: 0
3: 6
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070916582 Original CRISPR GTTCAACTGCACAGGGAACC GGG Intronic
900520300 1:3102186-3102208 GTCCAGCCGCACAGGGAGCCAGG + Intronic
901662679 1:10808478-10808500 GTTCTGCTGAACAGGGAACCAGG - Intergenic
902802561 1:18839501-18839523 GTTCAACTCCAGATGGAAGCAGG - Intergenic
904311482 1:29632452-29632474 TTTCAGCTGCACAGAGAACTAGG - Intergenic
905412311 1:37779124-37779146 GTTCAACTGCACCGGGAGTGTGG + Intergenic
915608366 1:156969834-156969856 GTACAAATACACAGGGAAGCTGG - Intronic
916709156 1:167386879-167386901 GATTAACTGCAAAGGGAACAAGG + Intronic
917539875 1:175902010-175902032 GTTCATCTGCTCATGGAGCCTGG - Intergenic
921595350 1:217048451-217048473 GTTCAACTGCAAATGGAGGCAGG + Intronic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
1066551645 10:36565022-36565044 TTTGTACTGCACAGGGATCCTGG + Intergenic
1067276425 10:44838912-44838934 GTTTTCCTGCACAGGGAAGCTGG - Intergenic
1067774603 10:49153960-49153982 GTCAACCTGCACAGGGAAGCAGG - Intergenic
1069937053 10:71924779-71924801 GTGCAACTGCACAGGGCCCTGGG + Intergenic
1070150440 10:73801819-73801841 GTTCATCTGCACATGGAATTTGG - Exonic
1070363563 10:75714310-75714332 TTTCATCTGCACAAGGAACATGG - Intronic
1070916582 10:80158914-80158936 GTTCAACTGCACAGGGAACCGGG + Intronic
1072781057 10:98252245-98252267 GTTCAGCAGCCCAGGGCACCTGG - Intronic
1073487348 10:103827984-103828006 GTAATTCTGCACAGGGAACCAGG - Intronic
1073829936 10:107372148-107372170 GCTCAACTGAACAGGGGCCCTGG + Intergenic
1075208894 10:120473860-120473882 GTTCCACTGTACAGGGAGCATGG - Intronic
1078544995 11:12240841-12240863 GTTCACATGGACAGGGAGCCAGG + Intronic
1081544228 11:44058548-44058570 CTTCAAATGTACAGGGATCCAGG - Exonic
1083184942 11:61012175-61012197 GTACAACTGCACAGGCTGCCGGG + Intronic
1083328986 11:61888378-61888400 GCTCAACTACACAGGGCACTGGG + Intronic
1084059977 11:66665302-66665324 GTTCCACTGCACAGGAAAAAGGG + Exonic
1087116773 11:94533909-94533931 ATTCAACTACAAAAGGAACCAGG - Intergenic
1088450596 11:109977579-109977601 GTTCATCTGCTCATGGAGCCTGG - Intergenic
1089114730 11:116085448-116085470 GTTCTACTCCTCTGGGAACCTGG + Intergenic
1091205670 11:133819153-133819175 GGAGAACTGCACAGTGAACCTGG + Intergenic
1093752128 12:22812065-22812087 GTTCAAATGCACATGGCTCCTGG - Intergenic
1101796410 12:107978819-107978841 GGACAACTGCTCAGGGAACTAGG - Intergenic
1101997555 12:109535747-109535769 CTTCCTCAGCACAGGGAACCCGG + Exonic
1103855480 12:123966509-123966531 GCTGAACTGCAGAGTGAACCTGG - Intronic
1112327125 13:98449370-98449392 GTCGGACTGCACAGGGAACACGG + Exonic
1113513946 13:110876551-110876573 ATTCAGCTGCACCAGGAACCTGG - Intergenic
1116643649 14:47498167-47498189 GGTCTACTGGACAGGAAACCTGG + Intronic
1117390336 14:55256368-55256390 GTTCATCTGCCCATGGAGCCTGG - Intergenic
1118896293 14:69948568-69948590 GTTCAACTTCACGGGGATGCTGG + Intronic
1122226365 14:100282842-100282864 GTTTCACTGCACATGAAACCAGG + Intergenic
1124425412 15:29558669-29558691 TTTCAACTGCAGAGGGAGTCAGG - Intronic
1127827467 15:62717695-62717717 GTTCCAGTGCACAGAGAGCCAGG + Intronic
1131601099 15:93849916-93849938 ATTCAACTGCATAGGTAACCAGG - Intergenic
1133951631 16:10399517-10399539 GATCAACTGAACAGAGAACCCGG - Intronic
1134125364 16:11612580-11612602 GCTCACGTGCACAGAGAACCTGG + Intronic
1138010751 16:53377490-53377512 GTGCCACTGCACTGGGAATCTGG - Intergenic
1142474796 17:182350-182372 GCTCAACTGCACAAGGACACCGG + Intergenic
1143450736 17:7035535-7035557 GTTGAACTTCTCAGGGATCCAGG + Intergenic
1149296880 17:55268970-55268992 TTTCATGTGCACAGGTAACCAGG + Intronic
1149531832 17:57401893-57401915 GTTCAGCTGCAAAGGGCCCCAGG - Intronic
1151242400 17:72768449-72768471 TTTCAATGGCACAGGGCACCAGG + Intronic
1151578621 17:74964984-74965006 GGTCAAATGCTCAGGGATCCAGG + Intronic
1153113301 18:1620342-1620364 GTTCAAGTGCACTGAGAACTCGG - Intergenic
1153305291 18:3625266-3625288 GTGCAACTGCACAGAGATCTTGG - Intronic
1156871362 18:41949316-41949338 GTACAACTGCACACAGATCCAGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1160153725 18:76415728-76415750 CTTCAACTGCATAGAGAAACCGG + Intronic
1162175847 19:8829610-8829632 GGTCAGATGCACAGGGACCCTGG - Intronic
1162609687 19:11739289-11739311 GCTCCACTGGACAGGGAGCCTGG - Intergenic
1162836443 19:13321724-13321746 GTTCAGCTGCATAGGGTACTTGG + Intronic
1163236747 19:16034349-16034371 GTCCAACTGACCAGGCAACCAGG - Intergenic
1164820762 19:31249442-31249464 GGTCAACTGAACAGGGACCTTGG + Intergenic
1165426501 19:35748723-35748745 TTTCACCTTCACAGGGAACATGG - Exonic
929043676 2:37770869-37770891 TTTCAACTCCACAAGGAAGCTGG + Intergenic
929171576 2:38937679-38937701 GTTCATCTGAAAAGGAAACCAGG - Intronic
929883973 2:45862356-45862378 GTTCCACTGGAGAGGGATCCAGG - Intronic
931433413 2:62227937-62227959 GCTCAACCCCACAGGGAATCTGG + Intergenic
933793118 2:85899389-85899411 GATCAACTGGAGAGGGGACCAGG + Intergenic
934088415 2:88529575-88529597 TTCCAACTGCACTGGGACCCTGG + Exonic
934700365 2:96434779-96434801 GTTCAACTCCAAAGGCAACAAGG - Intergenic
935446434 2:103161524-103161546 CTTCAACTGCACAGCGACCAAGG + Intergenic
938921823 2:136002219-136002241 ATGCAACTGCTCAGGGGACCAGG - Intergenic
940016848 2:149115477-149115499 GTTCAATTGCAAGGGGAATCAGG - Intronic
940084864 2:149847933-149847955 GTTCAGCTTCACACGGAGCCTGG - Intergenic
940627373 2:156192264-156192286 GTTCCACTGCAAATGGGACCTGG - Intergenic
948230077 2:236342870-236342892 GGTCAACTGCACTGAGGACCAGG - Intronic
948375098 2:237516018-237516040 TGTCAACTGCAAAGGGAAGCAGG - Intronic
948921394 2:241067615-241067637 CATCAACTGCTCAGGGAACTCGG - Intronic
1169876240 20:10300030-10300052 GTTAAACTGGAAATGGAACCTGG - Intronic
1171890733 20:30711576-30711598 TTTCAACAGCACAGGGATCAGGG + Intergenic
1174403325 20:50288026-50288048 ATTCAAATGCACAGGAGACCTGG + Intergenic
1177398010 21:20562680-20562702 ATTGTATTGCACAGGGAACCAGG - Intergenic
1177599223 21:23289108-23289130 GCTCAACACCACATGGAACCTGG - Intergenic
1178360576 21:31946046-31946068 GAGCAACTGCGCAGGGATCCTGG + Exonic
1179502712 21:41820119-41820141 CTTCAACAGCATCGGGAACCTGG - Exonic
1179996281 21:44975903-44975925 TGTCAACTGCCCAGGAAACCAGG + Intronic
1203295545 22_KI270736v1_random:40003-40025 GTTCAACAGCTCAGGGAAGAAGG + Intergenic
1203295815 22_KI270736v1_random:42281-42303 TTTCAGCTCCACAGGGAAGCTGG + Intergenic
953905849 3:46867929-46867951 GTGCAACTGGACAGGGACCTAGG - Intronic
955425995 3:58790486-58790508 GTTCATCTGCTCATGGAACCTGG - Intronic
957747823 3:84367402-84367424 GTTCAACCCCACTGGGAACGTGG - Intergenic
959267415 3:104160129-104160151 GTTCAAATGCCCAGGAAAACAGG - Intergenic
959973388 3:112431853-112431875 TTTCCACAGCACAGGGACCCTGG - Intergenic
962215662 3:133519055-133519077 GTTTAACTGCACAGGGACTGTGG - Intergenic
962559742 3:136592938-136592960 GTTCAAAGGCACAGACAACCTGG + Intronic
968664823 4:1815315-1815337 GGGCGACTGCACAGGGAGCCTGG - Intronic
969570580 4:8005972-8005994 GTGCATCTGCACAGGCAGCCTGG + Intronic
971405763 4:26320038-26320060 CCACTACTGCACAGGGAACCGGG - Intronic
973573927 4:52266937-52266959 GTTCATCTGGACACAGAACCAGG + Intergenic
983801264 4:171932436-171932458 GAACAGCTGCACAGGGAAGCTGG + Intronic
985589986 5:759599-759621 GTTCTTCTGCAAAGGGAAACAGG - Intronic
991557621 5:67913344-67913366 GTTCAGCTCCACACAGAACCTGG - Intergenic
991666808 5:69007470-69007492 TTACAACAGCACAGGAAACCAGG + Intergenic
994939980 5:106310808-106310830 GTTCCAGTGCACATGGACCCTGG - Intergenic
998540068 5:142972384-142972406 GTTCATCTGAATAGGGAACTTGG + Intronic
1003242034 6:4353348-4353370 GTGCAACCCCACAGGGAGCCAGG + Intergenic
1003581020 6:7341012-7341034 CTTCAAATGTACAGGGATCCAGG + Intronic
1004529324 6:16439068-16439090 TTTAAACTGCACAGGAAACAAGG + Intronic
1012488414 6:99748518-99748540 TTTCTACTGCATAGGGACCCGGG - Intergenic
1014166127 6:118227126-118227148 GCTCAACTGCACAGGACACCAGG + Intronic
1014992791 6:128103070-128103092 GCTCATCTGCTCAAGGAACCTGG - Intronic
1016356866 6:143227777-143227799 GTGCACATGCACAGGGACCCAGG + Intronic
1016865120 6:148758791-148758813 CTTCAACTGCTCAAGGAACTGGG - Intronic
1017740368 6:157400851-157400873 GCACAGCTGCACAGGGAGCCCGG - Intronic
1018497252 6:164361335-164361357 TTTCAACTCCACAGGTAGCCTGG - Intergenic
1023841858 7:44102625-44102647 GCTCAGGTGCACAGGGAGCCTGG + Intergenic
1026824684 7:73574050-73574072 GATCATCTGCACAGGTAGCCAGG + Exonic
1028466878 7:91162481-91162503 GTTGAACTGGGCAGGAAACCGGG + Intronic
1028694332 7:93691317-93691339 GTTCAAGTGCAGAGAGATCCTGG - Intronic
1029357364 7:100062143-100062165 GTTCAACTGCTGTGGGAACATGG + Intronic
1035958294 8:4107677-4107699 GTCCAACATGACAGGGAACCGGG + Intronic
1037356619 8:18026827-18026849 GTAAAACTGAACAGAGAACCAGG - Intronic
1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG + Exonic
1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG + Intronic
1041812294 8:61924824-61924846 GTCCTACTGCACAGTGTACCAGG + Intergenic
1042902945 8:73746675-73746697 GTTCCGCAGCACGGGGAACCCGG - Intronic
1043797531 8:84563066-84563088 GATGAACTGCACAGGAGACCTGG + Intronic
1044530779 8:93304983-93305005 ATTCAACTGCATACGGAGCCAGG + Intergenic
1044654788 8:94536161-94536183 GTTAGACTACACAGGGAAACTGG + Intronic
1045107184 8:98904304-98904326 GTTCCACTGCACAGGAAAAAGGG + Intronic
1045353555 8:101364299-101364321 GTTCATCTGCTCAGGCACCCTGG + Intergenic
1045501979 8:102750325-102750347 CTTCAACTGCACAGGCAGCTTGG + Intergenic
1047299837 8:123604122-123604144 TTTCAACTGCACAGGGGGTCAGG - Intergenic
1052479322 9:29002700-29002722 GGTCAACTGCACAGAAAACAAGG - Intergenic
1053147886 9:35724207-35724229 GTTCAGCTGTACAGGGTCCCGGG + Exonic
1053242631 9:36508460-36508482 GTTCAACTCCCAAGGGAAGCGGG + Intergenic
1054358124 9:64084219-64084241 TTTCAACTGCACAGGGATCAGGG - Intergenic
1060440348 9:123632869-123632891 GTGCCTATGCACAGGGAACCAGG - Intronic
1060488673 9:124065717-124065739 GTTCCACAGCAAAGGGACCCTGG - Intergenic
1062524767 9:136973720-136973742 GGTCCACTGCACCGGGATCCTGG + Intergenic
1185445163 X:254025-254047 GCACACCTGCAGAGGGAACCTGG - Intergenic
1186465191 X:9779339-9779361 CTTCACCTGCACAGAGAACAGGG - Intronic
1197415443 X:126166849-126166871 GTTCAAATGCTCAGGGATTCAGG - Intergenic