ID: 1070919526

View in Genome Browser
Species Human (GRCh38)
Location 10:80175426-80175448
Sequence CTCCATCCACAGCCAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070919519_1070919526 15 Left 1070919519 10:80175388-80175410 CCACTCCTGGCCTCCTCTCAGAG 0: 1
1: 1
2: 6
3: 62
4: 528
Right 1070919526 10:80175426-80175448 CTCCATCCACAGCCAGGCCAGGG No data
1070919521_1070919526 5 Left 1070919521 10:80175398-80175420 CCTCCTCTCAGAGAAATGAAGCC 0: 1
1: 0
2: 1
3: 41
4: 205
Right 1070919526 10:80175426-80175448 CTCCATCCACAGCCAGGCCAGGG No data
1070919517_1070919526 28 Left 1070919517 10:80175375-80175397 CCAAAGACACTCTCCACTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 204
Right 1070919526 10:80175426-80175448 CTCCATCCACAGCCAGGCCAGGG No data
1070919522_1070919526 2 Left 1070919522 10:80175401-80175423 CCTCTCAGAGAAATGAAGCCAAA 0: 1
1: 0
2: 4
3: 26
4: 288
Right 1070919526 10:80175426-80175448 CTCCATCCACAGCCAGGCCAGGG No data
1070919520_1070919526 10 Left 1070919520 10:80175393-80175415 CCTGGCCTCCTCTCAGAGAAATG 0: 1
1: 0
2: 1
3: 19
4: 237
Right 1070919526 10:80175426-80175448 CTCCATCCACAGCCAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070919526 Original CRISPR CTCCATCCACAGCCAGGCCA GGG Intronic
No off target data available for this crispr