ID: 1070927158

View in Genome Browser
Species Human (GRCh38)
Location 10:80232535-80232557
Sequence GAACCCTTCCTGGCTAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070927158_1070927164 25 Left 1070927158 10:80232535-80232557 CCTGTGTTAGCCAGGAAGGGTTC No data
Right 1070927164 10:80232583-80232605 GCCTCGGCCTCCCACAGTGCTGG 0: 689
1: 85909
2: 213551
3: 223810
4: 149624
1070927158_1070927160 9 Left 1070927158 10:80232535-80232557 CCTGTGTTAGCCAGGAAGGGTTC No data
Right 1070927160 10:80232567-80232589 ACCTTGTGATCCACCTGCCTCGG 0: 2218
1: 11744
2: 31060
3: 53139
4: 65038
1070927158_1070927166 26 Left 1070927158 10:80232535-80232557 CCTGTGTTAGCCAGGAAGGGTTC No data
Right 1070927166 10:80232584-80232606 CCTCGGCCTCCCACAGTGCTGGG 0: 1040
1: 127180
2: 276713
3: 209477
4: 120768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070927158 Original CRISPR GAACCCTTCCTGGCTAACAC AGG (reversed) Intergenic
No off target data available for this crispr