ID: 1070927440

View in Genome Browser
Species Human (GRCh38)
Location 10:80235115-80235137
Sequence ACGGCTACATCCACCTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070927437_1070927440 4 Left 1070927437 10:80235088-80235110 CCACTCACAGGTCCTGAGTCACA No data
Right 1070927440 10:80235115-80235137 ACGGCTACATCCACCTTCAAAGG No data
1070927439_1070927440 -8 Left 1070927439 10:80235100-80235122 CCTGAGTCACATCACACGGCTAC No data
Right 1070927440 10:80235115-80235137 ACGGCTACATCCACCTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070927440 Original CRISPR ACGGCTACATCCACCTTCAA AGG Intergenic
No off target data available for this crispr