ID: 1070928018

View in Genome Browser
Species Human (GRCh38)
Location 10:80238455-80238477
Sequence GTCCCTTGGAGGCTTGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070928018_1070928035 20 Left 1070928018 10:80238455-80238477 CCCTGGCCAAGCCTCCAAGGGAC No data
Right 1070928035 10:80238498-80238520 GGGAGGTTGACTCTGGCTTTGGG No data
1070928018_1070928028 0 Left 1070928018 10:80238455-80238477 CCCTGGCCAAGCCTCCAAGGGAC No data
Right 1070928028 10:80238478-80238500 CATGAGGGGCCCGCCTGCAAGGG No data
1070928018_1070928034 19 Left 1070928018 10:80238455-80238477 CCCTGGCCAAGCCTCCAAGGGAC No data
Right 1070928034 10:80238497-80238519 AGGGAGGTTGACTCTGGCTTTGG No data
1070928018_1070928027 -1 Left 1070928018 10:80238455-80238477 CCCTGGCCAAGCCTCCAAGGGAC No data
Right 1070928027 10:80238477-80238499 CCATGAGGGGCCCGCCTGCAAGG No data
1070928018_1070928029 3 Left 1070928018 10:80238455-80238477 CCCTGGCCAAGCCTCCAAGGGAC No data
Right 1070928029 10:80238481-80238503 GAGGGGCCCGCCTGCAAGGGAGG No data
1070928018_1070928036 21 Left 1070928018 10:80238455-80238477 CCCTGGCCAAGCCTCCAAGGGAC No data
Right 1070928036 10:80238499-80238521 GGAGGTTGACTCTGGCTTTGGGG No data
1070928018_1070928033 13 Left 1070928018 10:80238455-80238477 CCCTGGCCAAGCCTCCAAGGGAC No data
Right 1070928033 10:80238491-80238513 CCTGCAAGGGAGGTTGACTCTGG No data
1070928018_1070928037 24 Left 1070928018 10:80238455-80238477 CCCTGGCCAAGCCTCCAAGGGAC No data
Right 1070928037 10:80238502-80238524 GGTTGACTCTGGCTTTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070928018 Original CRISPR GTCCCTTGGAGGCTTGGCCA GGG (reversed) Intergenic
No off target data available for this crispr