ID: 1070928801

View in Genome Browser
Species Human (GRCh38)
Location 10:80245855-80245877
Sequence GGAAACACCCTGACTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070928801_1070928807 13 Left 1070928801 10:80245855-80245877 CCTACAAAAGTCAGGGTGTTTCC No data
Right 1070928807 10:80245891-80245913 TCCTGGCGTGTGACTCTTCTGGG No data
1070928801_1070928806 12 Left 1070928801 10:80245855-80245877 CCTACAAAAGTCAGGGTGTTTCC No data
Right 1070928806 10:80245890-80245912 TTCCTGGCGTGTGACTCTTCTGG No data
1070928801_1070928802 -4 Left 1070928801 10:80245855-80245877 CCTACAAAAGTCAGGGTGTTTCC No data
Right 1070928802 10:80245874-80245896 TTCCTGTCCACCTCTATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070928801 Original CRISPR GGAAACACCCTGACTTTTGT AGG (reversed) Intergenic
No off target data available for this crispr