ID: 1070929405

View in Genome Browser
Species Human (GRCh38)
Location 10:80250224-80250246
Sequence GCCTGTGCTCCGCTATTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070929405_1070929411 19 Left 1070929405 10:80250224-80250246 CCTGTGAATAGCGGAGCACAGGC No data
Right 1070929411 10:80250266-80250288 ATCATTCCACCCTGATGTCTTGG No data
1070929405_1070929406 -6 Left 1070929405 10:80250224-80250246 CCTGTGAATAGCGGAGCACAGGC No data
Right 1070929406 10:80250241-80250263 ACAGGCCCCTCCACTGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070929405 Original CRISPR GCCTGTGCTCCGCTATTCAC AGG (reversed) Intergenic
No off target data available for this crispr