ID: 1070930415

View in Genome Browser
Species Human (GRCh38)
Location 10:80256912-80256934
Sequence GACAGGGCAGCCCTTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070930415_1070930423 4 Left 1070930415 10:80256912-80256934 CCAGGGGAAAGGGCTGCCCTGTC No data
Right 1070930423 10:80256939-80256961 GTTTGCCTCCTCTGTGGGGTGGG No data
1070930415_1070930420 -1 Left 1070930415 10:80256912-80256934 CCAGGGGAAAGGGCTGCCCTGTC No data
Right 1070930420 10:80256934-80256956 CTCAGGTTTGCCTCCTCTGTGGG No data
1070930415_1070930421 0 Left 1070930415 10:80256912-80256934 CCAGGGGAAAGGGCTGCCCTGTC No data
Right 1070930421 10:80256935-80256957 TCAGGTTTGCCTCCTCTGTGGGG No data
1070930415_1070930419 -2 Left 1070930415 10:80256912-80256934 CCAGGGGAAAGGGCTGCCCTGTC No data
Right 1070930419 10:80256933-80256955 TCTCAGGTTTGCCTCCTCTGTGG No data
1070930415_1070930422 3 Left 1070930415 10:80256912-80256934 CCAGGGGAAAGGGCTGCCCTGTC No data
Right 1070930422 10:80256938-80256960 GGTTTGCCTCCTCTGTGGGGTGG No data
1070930415_1070930424 5 Left 1070930415 10:80256912-80256934 CCAGGGGAAAGGGCTGCCCTGTC No data
Right 1070930424 10:80256940-80256962 TTTGCCTCCTCTGTGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070930415 Original CRISPR GACAGGGCAGCCCTTTCCCC TGG (reversed) Intergenic
No off target data available for this crispr