ID: 1070930421

View in Genome Browser
Species Human (GRCh38)
Location 10:80256935-80256957
Sequence TCAGGTTTGCCTCCTCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070930406_1070930421 30 Left 1070930406 10:80256882-80256904 CCTCTGGGTCTGTCCCTGAAGCA No data
Right 1070930421 10:80256935-80256957 TCAGGTTTGCCTCCTCTGTGGGG No data
1070930409_1070930421 17 Left 1070930409 10:80256895-80256917 CCCTGAAGCAAGGACTTCCAGGG No data
Right 1070930421 10:80256935-80256957 TCAGGTTTGCCTCCTCTGTGGGG No data
1070930415_1070930421 0 Left 1070930415 10:80256912-80256934 CCAGGGGAAAGGGCTGCCCTGTC No data
Right 1070930421 10:80256935-80256957 TCAGGTTTGCCTCCTCTGTGGGG No data
1070930411_1070930421 16 Left 1070930411 10:80256896-80256918 CCTGAAGCAAGGACTTCCAGGGG No data
Right 1070930421 10:80256935-80256957 TCAGGTTTGCCTCCTCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070930421 Original CRISPR TCAGGTTTGCCTCCTCTGTG GGG Intergenic
No off target data available for this crispr