ID: 1070930424

View in Genome Browser
Species Human (GRCh38)
Location 10:80256940-80256962
Sequence TTTGCCTCCTCTGTGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070930411_1070930424 21 Left 1070930411 10:80256896-80256918 CCTGAAGCAAGGACTTCCAGGGG No data
Right 1070930424 10:80256940-80256962 TTTGCCTCCTCTGTGGGGTGGGG No data
1070930409_1070930424 22 Left 1070930409 10:80256895-80256917 CCCTGAAGCAAGGACTTCCAGGG No data
Right 1070930424 10:80256940-80256962 TTTGCCTCCTCTGTGGGGTGGGG No data
1070930415_1070930424 5 Left 1070930415 10:80256912-80256934 CCAGGGGAAAGGGCTGCCCTGTC No data
Right 1070930424 10:80256940-80256962 TTTGCCTCCTCTGTGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070930424 Original CRISPR TTTGCCTCCTCTGTGGGGTG GGG Intergenic
No off target data available for this crispr