ID: 1070932407

View in Genome Browser
Species Human (GRCh38)
Location 10:80270718-80270740
Sequence CAGTGTTAGGGAAATGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070932407_1070932413 4 Left 1070932407 10:80270718-80270740 CCGTCCACATTTCCCTAACACTG No data
Right 1070932413 10:80270745-80270767 ACTTGGCTTTGTGGCTCAGAAGG No data
1070932407_1070932414 7 Left 1070932407 10:80270718-80270740 CCGTCCACATTTCCCTAACACTG No data
Right 1070932414 10:80270748-80270770 TGGCTTTGTGGCTCAGAAGGTGG No data
1070932407_1070932412 -5 Left 1070932407 10:80270718-80270740 CCGTCCACATTTCCCTAACACTG No data
Right 1070932412 10:80270736-80270758 CACTGTGACACTTGGCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070932407 Original CRISPR CAGTGTTAGGGAAATGTGGA CGG (reversed) Intergenic
No off target data available for this crispr