ID: 1070932412

View in Genome Browser
Species Human (GRCh38)
Location 10:80270736-80270758
Sequence CACTGTGACACTTGGCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070932401_1070932412 20 Left 1070932401 10:80270693-80270715 CCGCTCCCTGCCAACCTCCTTTG No data
Right 1070932412 10:80270736-80270758 CACTGTGACACTTGGCTTTGTGG No data
1070932407_1070932412 -5 Left 1070932407 10:80270718-80270740 CCGTCCACATTTCCCTAACACTG No data
Right 1070932412 10:80270736-80270758 CACTGTGACACTTGGCTTTGTGG No data
1070932400_1070932412 27 Left 1070932400 10:80270686-80270708 CCACTGGCCGCTCCCTGCCAACC No data
Right 1070932412 10:80270736-80270758 CACTGTGACACTTGGCTTTGTGG No data
1070932404_1070932412 10 Left 1070932404 10:80270703-80270725 CCAACCTCCTTTGCTCCGTCCAC No data
Right 1070932412 10:80270736-80270758 CACTGTGACACTTGGCTTTGTGG No data
1070932405_1070932412 6 Left 1070932405 10:80270707-80270729 CCTCCTTTGCTCCGTCCACATTT No data
Right 1070932412 10:80270736-80270758 CACTGTGACACTTGGCTTTGTGG No data
1070932406_1070932412 3 Left 1070932406 10:80270710-80270732 CCTTTGCTCCGTCCACATTTCCC No data
Right 1070932412 10:80270736-80270758 CACTGTGACACTTGGCTTTGTGG No data
1070932403_1070932412 14 Left 1070932403 10:80270699-80270721 CCTGCCAACCTCCTTTGCTCCGT No data
Right 1070932412 10:80270736-80270758 CACTGTGACACTTGGCTTTGTGG No data
1070932408_1070932412 -9 Left 1070932408 10:80270722-80270744 CCACATTTCCCTAACACTGTGAC No data
Right 1070932412 10:80270736-80270758 CACTGTGACACTTGGCTTTGTGG No data
1070932402_1070932412 15 Left 1070932402 10:80270698-80270720 CCCTGCCAACCTCCTTTGCTCCG No data
Right 1070932412 10:80270736-80270758 CACTGTGACACTTGGCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070932412 Original CRISPR CACTGTGACACTTGGCTTTG TGG Intergenic
No off target data available for this crispr