ID: 1070932413

View in Genome Browser
Species Human (GRCh38)
Location 10:80270745-80270767
Sequence ACTTGGCTTTGTGGCTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070932406_1070932413 12 Left 1070932406 10:80270710-80270732 CCTTTGCTCCGTCCACATTTCCC No data
Right 1070932413 10:80270745-80270767 ACTTGGCTTTGTGGCTCAGAAGG No data
1070932401_1070932413 29 Left 1070932401 10:80270693-80270715 CCGCTCCCTGCCAACCTCCTTTG No data
Right 1070932413 10:80270745-80270767 ACTTGGCTTTGTGGCTCAGAAGG No data
1070932410_1070932413 -8 Left 1070932410 10:80270730-80270752 CCCTAACACTGTGACACTTGGCT No data
Right 1070932413 10:80270745-80270767 ACTTGGCTTTGTGGCTCAGAAGG No data
1070932405_1070932413 15 Left 1070932405 10:80270707-80270729 CCTCCTTTGCTCCGTCCACATTT No data
Right 1070932413 10:80270745-80270767 ACTTGGCTTTGTGGCTCAGAAGG No data
1070932403_1070932413 23 Left 1070932403 10:80270699-80270721 CCTGCCAACCTCCTTTGCTCCGT No data
Right 1070932413 10:80270745-80270767 ACTTGGCTTTGTGGCTCAGAAGG No data
1070932402_1070932413 24 Left 1070932402 10:80270698-80270720 CCCTGCCAACCTCCTTTGCTCCG No data
Right 1070932413 10:80270745-80270767 ACTTGGCTTTGTGGCTCAGAAGG No data
1070932404_1070932413 19 Left 1070932404 10:80270703-80270725 CCAACCTCCTTTGCTCCGTCCAC No data
Right 1070932413 10:80270745-80270767 ACTTGGCTTTGTGGCTCAGAAGG No data
1070932411_1070932413 -9 Left 1070932411 10:80270731-80270753 CCTAACACTGTGACACTTGGCTT No data
Right 1070932413 10:80270745-80270767 ACTTGGCTTTGTGGCTCAGAAGG No data
1070932407_1070932413 4 Left 1070932407 10:80270718-80270740 CCGTCCACATTTCCCTAACACTG No data
Right 1070932413 10:80270745-80270767 ACTTGGCTTTGTGGCTCAGAAGG No data
1070932408_1070932413 0 Left 1070932408 10:80270722-80270744 CCACATTTCCCTAACACTGTGAC No data
Right 1070932413 10:80270745-80270767 ACTTGGCTTTGTGGCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070932413 Original CRISPR ACTTGGCTTTGTGGCTCAGA AGG Intergenic
No off target data available for this crispr