ID: 1070933274

View in Genome Browser
Species Human (GRCh38)
Location 10:80275402-80275424
Sequence CTTGCTAATGAAGCTTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070933274_1070933282 5 Left 1070933274 10:80275402-80275424 CCTGCCAAAGCTTCATTAGCAAG 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1070933282 10:80275430-80275452 AAGGTGGGCCAGGGGTTCTCTGG 0: 1
1: 1
2: 1
3: 36
4: 277
1070933274_1070933279 -5 Left 1070933274 10:80275402-80275424 CCTGCCAAAGCTTCATTAGCAAG 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1070933279 10:80275420-80275442 GCAAGTGCAGAAGGTGGGCCAGG 0: 1
1: 0
2: 2
3: 46
4: 452
1070933274_1070933280 -4 Left 1070933274 10:80275402-80275424 CCTGCCAAAGCTTCATTAGCAAG 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1070933280 10:80275421-80275443 CAAGTGCAGAAGGTGGGCCAGGG 0: 1
1: 0
2: 3
3: 23
4: 301
1070933274_1070933283 6 Left 1070933274 10:80275402-80275424 CCTGCCAAAGCTTCATTAGCAAG 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1070933283 10:80275431-80275453 AGGTGGGCCAGGGGTTCTCTGGG 0: 1
1: 0
2: 4
3: 37
4: 289
1070933274_1070933278 -10 Left 1070933274 10:80275402-80275424 CCTGCCAAAGCTTCATTAGCAAG 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1070933278 10:80275415-80275437 CATTAGCAAGTGCAGAAGGTGGG 0: 1
1: 0
2: 2
3: 12
4: 193
1070933274_1070933281 -3 Left 1070933274 10:80275402-80275424 CCTGCCAAAGCTTCATTAGCAAG 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1070933281 10:80275422-80275444 AAGTGCAGAAGGTGGGCCAGGGG 0: 1
1: 0
2: 2
3: 27
4: 298
1070933274_1070933284 7 Left 1070933274 10:80275402-80275424 CCTGCCAAAGCTTCATTAGCAAG 0: 1
1: 0
2: 1
3: 10
4: 170
Right 1070933284 10:80275432-80275454 GGTGGGCCAGGGGTTCTCTGGGG 0: 1
1: 0
2: 11
3: 49
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070933274 Original CRISPR CTTGCTAATGAAGCTTTGGC AGG (reversed) Intronic
900706728 1:4085534-4085556 CATGCTAATGCAACTTTGGATGG - Intergenic
907611454 1:55875283-55875305 CTTGGTAGGGAAGCTTTGACAGG + Intergenic
909374677 1:74925790-74925812 TTTGCTTATGAAGCTTAGTCTGG - Intergenic
910821922 1:91360013-91360035 TTTGCTTATGAAGCTTTGTTTGG - Intronic
910954958 1:92693027-92693049 CTTTCTAATGAAGCTTTTTTTGG - Intronic
911546877 1:99227888-99227910 CTTCCTAATGTAACTGTGGCTGG - Intergenic
915876539 1:159616786-159616808 CTGGCTACAGAAGCTTTGCCAGG - Intergenic
920947912 1:210546850-210546872 CTTGATAATGAAGCCTGGGTGGG + Intronic
922294891 1:224241135-224241157 GTTGCTAATGAAACTTTTGGAGG - Intronic
923350302 1:233098284-233098306 CTTGCAGATGAAGCTTTCCCTGG - Intronic
923855312 1:237839243-237839265 ATTGCAGATGAAGCTTTGGTGGG + Intergenic
924007850 1:239631934-239631956 CTTGCAACTGGAGCTTAGGCAGG + Intronic
924253198 1:242156600-242156622 CTTGCTTATGAAGCTTAGTTTGG + Intronic
924410862 1:243803990-243804012 CTTGAGAATGAAGCCATGGCAGG + Intronic
1064217883 10:13415889-13415911 CTTGGTAATGGAGTTTTGACTGG + Intergenic
1065968626 10:30788313-30788335 CTGGCTATTGCAGCTCTGGCTGG + Intergenic
1066531583 10:36346439-36346461 CTTACTAATGTATCTTTCGCTGG - Intergenic
1070074895 10:73125450-73125472 CTTGGGAAAGGAGCTTTGGCGGG - Exonic
1070727943 10:78804770-78804792 CTTCCTAAGGACACTTTGGCTGG - Intergenic
1070933274 10:80275402-80275424 CTTGCTAATGAAGCTTTGGCAGG - Intronic
1071454870 10:85838553-85838575 TTTGCTAATGAAGCTTAGTTTGG - Intronic
1074028443 10:109661484-109661506 TTTGCTTATGAAGCTTAGGTTGG + Intergenic
1076029173 10:127143114-127143136 CTTGCTAAAGAAACTGTGGCAGG - Intronic
1078336557 11:10467910-10467932 TTTGCTTATGAAGCTTTGTTTGG - Intronic
1079258597 11:18854598-18854620 CTTGCTTATGAAGCTTAGCTTGG - Intergenic
1086903922 11:92397484-92397506 GTTTCTTTTGAAGCTTTGGCTGG + Intronic
1087377975 11:97367977-97367999 CCTGCAGATGAAGCCTTGGCAGG + Intergenic
1088345032 11:108814112-108814134 CTTCCTAATAAAGCTTTGGGTGG - Intronic
1091000640 11:131908263-131908285 CATACTAATGAAGCAATGGCAGG + Intronic
1091709706 12:2730543-2730565 CTTCCTAATGAAGTTTTGGAAGG + Intergenic
1094060877 12:26314562-26314584 TTTGCTAATGAAGCTTAGTTTGG + Intergenic
1096610074 12:52795379-52795401 CAAGGTAATGAAGCTTTGACTGG - Exonic
1097038217 12:56138111-56138133 TTTGAGAATGAAGCTTGGGCAGG - Intronic
1097305535 12:58064767-58064789 CATGCTCATTAAGCTTTGCCAGG + Intergenic
1100036617 12:90259585-90259607 CTTTTTAATGAACATTTGGCTGG + Intergenic
1101753310 12:107601206-107601228 CTTGCTAAGGGATCTTGGGCAGG - Intronic
1101796573 12:107980402-107980424 CTTACTAGGGAAGCTGTGGCAGG - Intergenic
1102618274 12:114173552-114173574 ATTGCTACTGAAGCTGTGGTGGG - Intergenic
1103891252 12:124240670-124240692 CTGGCTAATGATCCATTGGCTGG - Intronic
1104732289 12:131114415-131114437 CTTGCAAATGGAGCGCTGGCTGG + Intronic
1106313406 13:28573570-28573592 CTTGCTAATATTGCTTTGGGGGG + Intergenic
1107532404 13:41296267-41296289 CTTGCTAATGTAGCCCAGGCTGG + Intergenic
1107767738 13:43755897-43755919 CTTGGTAATGAACCATGGGCTGG - Intronic
1109325941 13:60868265-60868287 CTTGCTTATGAAGCTTAGTTTGG + Intergenic
1113380482 13:109800049-109800071 CTTGCTAATGATTATTTGGTAGG + Intergenic
1113960438 13:114122887-114122909 CTTTCTCATGCAGCGTTGGCTGG - Intronic
1114173062 14:20293932-20293954 CTTGGAAATGAAGCTTGGGCTGG + Intronic
1115928643 14:38466297-38466319 TTTGCTAATGAAGCTTAGTTTGG + Intergenic
1116090185 14:40294733-40294755 TTTGCTTATGAAGCTTAGGTTGG + Intergenic
1116174070 14:41442940-41442962 CTTGCTCTTGTAGCTTAGGCTGG - Intergenic
1118452195 14:65913257-65913279 CTTGCTGAGGAAGCTGAGGCCGG + Intergenic
1118662876 14:68034078-68034100 GTTGTTAATGTAGCTTTGGGGGG + Intronic
1119965369 14:78909457-78909479 CTTGCTATTGAAGCTTTCTTGGG - Intronic
1120823770 14:88936638-88936660 CTTACTTAGGAAGCTGTGGCAGG - Intergenic
1121445520 14:93976379-93976401 CTTGCAAAAGATTCTTTGGCTGG - Intronic
1121650079 14:95551783-95551805 CTTCTTTAGGAAGCTTTGGCAGG - Intergenic
1126284383 15:46995047-46995069 CTTGCTTATGAAGCTTAGTTTGG + Intergenic
1126500858 15:49342773-49342795 CTTGCTTATGAAGCTTAGTTTGG + Intronic
1127843979 15:62853662-62853684 TTTGACAATGAAGCTTTGGATGG + Intergenic
1133844328 16:9440020-9440042 CTTGCTAAAGAGGCTCTGGAAGG + Intergenic
1133988305 16:10685005-10685027 CTGGCTAATGAGGCTCTGGCTGG + Intronic
1135285517 16:21189509-21189531 CTTGCTACTCAAGGTGTGGCCGG - Intergenic
1135728618 16:24876273-24876295 GTTGACAAAGAAGCTTTGGCAGG - Intronic
1135800192 16:25487381-25487403 TTTGCTTATGAAGCTTAGTCTGG + Intergenic
1139314757 16:66058882-66058904 CTTTCTAGTGAAGCTTTCTCAGG + Intergenic
1140074951 16:71689708-71689730 CTTGCTAATGTTGCTCAGGCTGG + Intronic
1140274211 16:73494315-73494337 TCTGCTAATGAAGATATGGCTGG + Intergenic
1143012940 17:3876223-3876245 CTTCCCACTGAAGCTCTGGCCGG + Exonic
1144406763 17:14959354-14959376 CTTGCTACTCAAACTGTGGCTGG + Intergenic
1145166446 17:20616239-20616261 CTTAGTAATAAAGCTTTGGCTGG - Intergenic
1148478745 17:47946265-47946287 CTTGTTAATGAATCATTGACTGG + Intronic
1149195342 17:54112998-54113020 CTTTCTAATGAAGCTTTCCCAGG - Intergenic
1149429966 17:56589700-56589722 CTTGCAAAGGAAGCTGTGGGCGG - Intergenic
1156898808 18:42276870-42276892 CTTCCTGATGAAGCTTGGGGAGG + Intergenic
1158174426 18:54638378-54638400 CTTGGTAGTGAAGCTTTAGTTGG - Intergenic
1163264982 19:16215069-16215091 TTTGCTGATGAAGCTTAGGTTGG + Intronic
928418771 2:31121190-31121212 CTTACAGATGAAGCCTTGGCAGG - Intronic
928788228 2:34916678-34916700 CTTGCTTATGAAGCTTAGTTTGG - Intergenic
931133111 2:59361741-59361763 CTTGCTAGGGAAGCTGAGGCAGG - Intergenic
933186145 2:79281070-79281092 TGTGCTAATGATGCTTTAGCTGG - Intronic
936795778 2:116202819-116202841 TTTGCTAATGAAGCTTAGTTTGG + Intergenic
942587244 2:177494878-177494900 CTTGATCATGAAGCCATGGCAGG - Intronic
945132411 2:206587327-206587349 CTTGCTTATGAAGATTTGGTGGG - Exonic
946683228 2:222239797-222239819 CTTGCTAAAGAGTCTTTTGCTGG - Intronic
947182108 2:227420496-227420518 CTTCTTAATGAAGCATTGCCTGG - Intergenic
1170207090 20:13810189-13810211 CTTGGTACTGAGGCTTTAGCAGG + Intronic
1177511167 21:22090265-22090287 CTTGCTTATGAAGCTTAGTTTGG + Intergenic
1178243534 21:30930015-30930037 CTTGCTGGTGAAGCTTTCCCAGG + Intergenic
1182666070 22:31960919-31960941 CTTGATAATGAAGCTATTGTTGG + Intergenic
1182976887 22:34630815-34630837 CTTGCTCATGAAGCTTAGTTTGG - Intergenic
1184319487 22:43729289-43729311 CTTGCTAATGTTGCCTAGGCTGG + Intronic
949423324 3:3889849-3889871 CTTGCTTATGAAGCTTAGCTTGG + Intronic
950948246 3:16973229-16973251 CTTGCTTATGAAGCTTAGTTTGG + Intronic
951740681 3:25919519-25919541 TTTGCTTATGAAGCTTTGATAGG - Intergenic
952574738 3:34760725-34760747 CTTCATAATGAAGCTTAGTCTGG - Intergenic
953175493 3:40547963-40547985 CTTTGTAATGAAGGTTTGCCGGG - Intronic
953902194 3:46849698-46849720 CTTGCTAAGGAAGCTCTGCATGG - Intergenic
954282282 3:49590130-49590152 ATTGAAAATGAAGATTTGGCGGG - Intronic
955951557 3:64247727-64247749 ATTGCTAAAGAAATTTTGGCAGG - Intronic
957210926 3:77257406-77257428 CTTGCCAATTAAACTTTGCCAGG - Intronic
958464674 3:94443020-94443042 ATTGCTGATGGAGCCTTGGCAGG + Intergenic
959291203 3:104476366-104476388 TTTGCTTATGAAGCTTAGGTTGG - Intergenic
959453958 3:106535935-106535957 TTTGCTTATGAAGCTTAGGGTGG - Intergenic
959534803 3:107472255-107472277 TTTGCTAATGAAGCTTAGTTTGG - Intergenic
959942834 3:112097264-112097286 TTTACTAATGAAGTTTTGGTTGG + Intronic
963224876 3:142852063-142852085 CTTTCAAAAGAAGCTTTGTCGGG - Intronic
963468261 3:145710479-145710501 ATTGTTAATGAATCTTTGTCGGG + Intergenic
963477638 3:145827386-145827408 TTTGCTAATGAAGCTTAGTTTGG + Intergenic
963709406 3:148729551-148729573 ATTGCTAATGAAGTTTTCACAGG + Intronic
964974544 3:162603184-162603206 TTTGCTTATGAAGCTTAGTCTGG - Intergenic
965938306 3:174143613-174143635 CTTGCTGATGGAGATTTGGTGGG + Intronic
967202315 3:187083084-187083106 CCCGCTAATAAAGCTTTGGTAGG + Intergenic
967335274 3:188337240-188337262 CTTGGAAATGGAGCTTTGGCTGG - Intronic
969278493 4:6153133-6153155 CTTGATTTTGAAGCCTTGGCTGG - Intronic
971217838 4:24677812-24677834 CTAGATAACGCAGCTTTGGCAGG + Intergenic
972101633 4:35427310-35427332 CCTGCTAAGGAAGTTTAGGCAGG - Intergenic
973837674 4:54826596-54826618 CTTGCTTATGAAGCTTAGTTTGG - Intergenic
974271674 4:59657844-59657866 TTTGCTTATGAAGCTTAGGTTGG - Intergenic
976154962 4:82133867-82133889 TTTGCTAATGTATCTTTGGTAGG - Intergenic
976935342 4:90624037-90624059 CTACTTAATGAAGCTTTGGAAGG + Intronic
978043938 4:104103264-104103286 GTTGTTAATGAAAATTTGGCTGG - Intergenic
978076081 4:104531546-104531568 CTTCCTGCTGAAACTTTGGCAGG - Intergenic
979529295 4:121751728-121751750 CATGCTAATGAGGTTTAGGCTGG - Intergenic
980257482 4:130401076-130401098 TTCGCTTATGAAGGTTTGGCTGG + Intergenic
983420017 4:167505499-167505521 TTTGCTTATGAAGCTTTGTTTGG + Intergenic
984189109 4:176583565-176583587 TTTTCTCAAGAAGCTTTGGCTGG + Intergenic
988368631 5:30337112-30337134 CTAGTTAATGAAGATATGGCTGG + Intergenic
989719619 5:44509249-44509271 CTTGCTATTGGACCTTTTGCAGG + Intergenic
993381664 5:87216139-87216161 TTTGCTAATGAAGCTTAGTTTGG + Intergenic
993779038 5:92042478-92042500 ATTGCAAATCAAGCTTAGGCTGG - Intergenic
997395109 5:133553424-133553446 CTTGCTACTGTAGCTTTGCTAGG - Intronic
1000393393 5:160748285-160748307 CTTGCTAGTGAAGCTTAGACAGG + Intronic
1002987315 6:2202988-2203010 CTTGCAAATGAAAATGTGGCAGG - Intronic
1004787728 6:18987760-18987782 CTTGTTACAGCAGCTTTGGCAGG + Intergenic
1005843877 6:29762741-29762763 CTTGCAACTCAAGCTTTGCCTGG + Intergenic
1006585554 6:35108388-35108410 CTCCCTGATGAAGGTTTGGCAGG - Intergenic
1008208319 6:48689323-48689345 CTTGCTTATGAAGCTTAGTTTGG - Intergenic
1008232687 6:49003549-49003571 CTGGCAAATGATGCTATGGCAGG - Intergenic
1013115479 6:107100561-107100583 CTTTCTAATGAAGCTTAGGCTGG - Intronic
1014095596 6:117457077-117457099 CTTGCTTATCAGGCTTTCGCTGG - Intronic
1014383826 6:120777594-120777616 TTTGCTTATGAAGCTTAGTCTGG + Intergenic
1014569231 6:122988092-122988114 TTTGCTTATGAAGCTTAGTCTGG - Intergenic
1015046438 6:128781551-128781573 CTTGCTAATCAAACTTAGGTTGG + Intergenic
1016726555 6:147376697-147376719 CTTACTCATGAAGCTGAGGCAGG + Intronic
1018741833 6:166735117-166735139 CATGCTGGAGAAGCTTTGGCAGG + Intronic
1021459339 7:20868378-20868400 CTTGCTAAAGAAACTGTGGAAGG - Intergenic
1022198668 7:28094882-28094904 CTTACTAAGGGAGCTTTGGTAGG - Intronic
1022961635 7:35431854-35431876 TTTGCTTATGAAGCTTAGGTTGG - Intergenic
1025727564 7:64081364-64081386 ATTGTAGATGAAGCTTTGGCGGG - Intronic
1028083062 7:86600893-86600915 ATTGCAGATGAAGCCTTGGCAGG + Intergenic
1033262006 7:139852056-139852078 CTTGCTTATGGAGCTGTAGCTGG - Intronic
1036012903 8:4747803-4747825 TTTACAAATGATGCTTTGGCTGG - Intronic
1037119669 8:15267412-15267434 CTTGCTCATGAATCTCTGGAAGG + Intergenic
1037582728 8:20255134-20255156 CTTGCTGTGGAAGCTGTGGCCGG + Exonic
1040372159 8:46787923-46787945 ATTGTAAATGAAGCTTTGGTGGG - Intergenic
1041752676 8:61278042-61278064 CTTTCTAATGGTGGTTTGGCAGG + Intronic
1042976519 8:74476530-74476552 TTTGCTTATGAAGCTTAGTCTGG + Intronic
1044494520 8:92861016-92861038 CTTGCTATTGAATCTTGAGCAGG + Intergenic
1047861814 8:128975642-128975664 CTTGCAAATGATGCTTTGTAAGG + Intergenic
1051387721 9:16527563-16527585 CCTGCTATTGAAGCTTATGCAGG - Intronic
1051663077 9:19443686-19443708 CTTGCTCTTGAAGCTCAGGCTGG + Intronic
1059954789 9:119504073-119504095 TTTGCTAATGAAGCTTAGTTTGG - Intronic
1061076566 9:128345049-128345071 CTGGCTCATGAAGCATAGGCTGG + Intronic
1062676999 9:137752564-137752586 CTTTCTCATGAGGCTTTGCCAGG - Intronic
1187551895 X:20314223-20314245 CTTGTTAAAGAAGCCTTGCCTGG + Intergenic
1189229280 X:39439561-39439583 CTTGATAATGCACCTTTGACTGG - Intergenic
1189878368 X:45461667-45461689 CTTGCTTATGAAGCTTAGTTTGG + Intergenic
1189930310 X:46002578-46002600 TTTGCTAATGAAGCTTAGTTTGG + Intergenic
1190561454 X:51689972-51689994 CTTGCTAATGATAATTTTGCAGG + Intergenic
1190562837 X:51703345-51703367 CTTGCTAATGATAATTTTGCAGG - Intergenic
1191799746 X:65065390-65065412 ATTGCTTATGAAGCTTTGTTTGG + Intergenic
1192771710 X:74199551-74199573 CTCTCTAATGAAGCTTTCCCAGG - Intergenic
1193316731 X:80073590-80073612 CTTACTTATGAAGCTTTGTTTGG + Intergenic
1195329439 X:103785371-103785393 CTTGAAAATAAATCTTTGGCCGG - Intronic
1196586986 X:117441296-117441318 CTTGCTTATGAAGCTTAGTTTGG - Intergenic
1197089003 X:122514143-122514165 TTTGCTTATGAAGCTTAGTCTGG - Intergenic
1197374536 X:125665484-125665506 TTTGCTAATGAAGCTTAGTTTGG - Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic
1198888613 X:141367224-141367246 CTTGCTTATGAAGCTTAGTTTGG - Intergenic
1199205238 X:145140843-145140865 CTTGCTAAGGAGGCTGTGACAGG + Intergenic
1201304000 Y:12535172-12535194 CTTGCTAATGATGGTTTATCTGG + Intergenic
1201371291 Y:13267763-13267785 CTTGCTTATGAAGCTTAGTTTGG + Intronic