ID: 1070935227

View in Genome Browser
Species Human (GRCh38)
Location 10:80288891-80288913
Sequence GCTGGTGGTGGGCCACAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070935222_1070935227 -7 Left 1070935222 10:80288875-80288897 CCCACTGTGCTGGCGTGCTGGTG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1070935227 10:80288891-80288913 GCTGGTGGTGGGCCACAGCACGG No data
1070935219_1070935227 4 Left 1070935219 10:80288864-80288886 CCTGTCTTGGACCCACTGTGCTG 0: 1
1: 0
2: 0
3: 10
4: 197
Right 1070935227 10:80288891-80288913 GCTGGTGGTGGGCCACAGCACGG No data
1070935223_1070935227 -8 Left 1070935223 10:80288876-80288898 CCACTGTGCTGGCGTGCTGGTGG 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1070935227 10:80288891-80288913 GCTGGTGGTGGGCCACAGCACGG No data
1070935218_1070935227 5 Left 1070935218 10:80288863-80288885 CCCTGTCTTGGACCCACTGTGCT 0: 1
1: 0
2: 1
3: 19
4: 222
Right 1070935227 10:80288891-80288913 GCTGGTGGTGGGCCACAGCACGG No data
1070935215_1070935227 21 Left 1070935215 10:80288847-80288869 CCAGCCAGCTGCTACTCCCTGTC No data
Right 1070935227 10:80288891-80288913 GCTGGTGGTGGGCCACAGCACGG No data
1070935216_1070935227 17 Left 1070935216 10:80288851-80288873 CCAGCTGCTACTCCCTGTCTTGG 0: 1
1: 0
2: 1
3: 29
4: 242
Right 1070935227 10:80288891-80288913 GCTGGTGGTGGGCCACAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070935227 Original CRISPR GCTGGTGGTGGGCCACAGCA CGG Intronic
No off target data available for this crispr