ID: 1070935551

View in Genome Browser
Species Human (GRCh38)
Location 10:80291982-80292004
Sequence CCCCCCAATAAAAAAACATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070935551_1070935555 4 Left 1070935551 10:80291982-80292004 CCTTATGTTTTTTTATTGGGGGG No data
Right 1070935555 10:80292009-80292031 GAAGTCTCACTCTGTCACCCAGG 0: 554
1: 13695
2: 52411
3: 117650
4: 150891
1070935551_1070935556 8 Left 1070935551 10:80291982-80292004 CCTTATGTTTTTTTATTGGGGGG No data
Right 1070935556 10:80292013-80292035 TCTCACTCTGTCACCCAGGCTGG 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
1070935551_1070935557 18 Left 1070935551 10:80291982-80292004 CCTTATGTTTTTTTATTGGGGGG No data
Right 1070935557 10:80292023-80292045 TCACCCAGGCTGGAGTGCAATGG 0: 14249
1: 108577
2: 215203
3: 218267
4: 141562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070935551 Original CRISPR CCCCCCAATAAAAAAACATA AGG (reversed) Intergenic
No off target data available for this crispr