ID: 1070935555

View in Genome Browser
Species Human (GRCh38)
Location 10:80292009-80292031
Sequence GAAGTCTCACTCTGTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335201
Summary {0: 554, 1: 13695, 2: 52411, 3: 117650, 4: 150891}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070935551_1070935555 4 Left 1070935551 10:80291982-80292004 CCTTATGTTTTTTTATTGGGGGG No data
Right 1070935555 10:80292009-80292031 GAAGTCTCACTCTGTCACCCAGG 0: 554
1: 13695
2: 52411
3: 117650
4: 150891

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070935555 Original CRISPR GAAGTCTCACTCTGTCACCC AGG Intergenic
Too many off-targets to display for this crispr