ID: 1070935557

View in Genome Browser
Species Human (GRCh38)
Location 10:80292023-80292045
Sequence TCACCCAGGCTGGAGTGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 697858
Summary {0: 14249, 1: 108577, 2: 215203, 3: 218267, 4: 141562}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070935551_1070935557 18 Left 1070935551 10:80291982-80292004 CCTTATGTTTTTTTATTGGGGGG No data
Right 1070935557 10:80292023-80292045 TCACCCAGGCTGGAGTGCAATGG 0: 14249
1: 108577
2: 215203
3: 218267
4: 141562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070935557 Original CRISPR TCACCCAGGCTGGAGTGCAA TGG Intergenic
Too many off-targets to display for this crispr