ID: 1070935654

View in Genome Browser
Species Human (GRCh38)
Location 10:80292956-80292978
Sequence AACTGCTCAGTGGGACTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070935654_1070935663 23 Left 1070935654 10:80292956-80292978 CCTGTAAGTCCCACTGAGCAGTT No data
Right 1070935663 10:80293002-80293024 CTGACCCTAGGCAGCACCACGGG No data
1070935654_1070935659 -3 Left 1070935654 10:80292956-80292978 CCTGTAAGTCCCACTGAGCAGTT No data
Right 1070935659 10:80292976-80292998 GTTTAGTGATGGAGCTTCGAGGG No data
1070935654_1070935660 11 Left 1070935654 10:80292956-80292978 CCTGTAAGTCCCACTGAGCAGTT No data
Right 1070935660 10:80292990-80293012 CTTCGAGGGCACCTGACCCTAGG No data
1070935654_1070935658 -4 Left 1070935654 10:80292956-80292978 CCTGTAAGTCCCACTGAGCAGTT No data
Right 1070935658 10:80292975-80292997 AGTTTAGTGATGGAGCTTCGAGG No data
1070935654_1070935664 24 Left 1070935654 10:80292956-80292978 CCTGTAAGTCCCACTGAGCAGTT No data
Right 1070935664 10:80293003-80293025 TGACCCTAGGCAGCACCACGGGG No data
1070935654_1070935662 22 Left 1070935654 10:80292956-80292978 CCTGTAAGTCCCACTGAGCAGTT No data
Right 1070935662 10:80293001-80293023 CCTGACCCTAGGCAGCACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070935654 Original CRISPR AACTGCTCAGTGGGACTTAC AGG (reversed) Intergenic
No off target data available for this crispr