ID: 1070942312

View in Genome Browser
Species Human (GRCh38)
Location 10:80358056-80358078
Sequence AAGCCCACTCAGACCAACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070942312_1070942314 -5 Left 1070942312 10:80358056-80358078 CCTAAGTTGGTCTGAGTGGGCTT No data
Right 1070942314 10:80358074-80358096 GGCTTTAAAAGGCATCCCCTTGG No data
1070942312_1070942316 5 Left 1070942312 10:80358056-80358078 CCTAAGTTGGTCTGAGTGGGCTT No data
Right 1070942316 10:80358084-80358106 GGCATCCCCTTGGCCAGGCGCGG No data
1070942312_1070942317 8 Left 1070942312 10:80358056-80358078 CCTAAGTTGGTCTGAGTGGGCTT No data
Right 1070942317 10:80358087-80358109 ATCCCCTTGGCCAGGCGCGGTGG No data
1070942312_1070942315 0 Left 1070942312 10:80358056-80358078 CCTAAGTTGGTCTGAGTGGGCTT No data
Right 1070942315 10:80358079-80358101 TAAAAGGCATCCCCTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070942312 Original CRISPR AAGCCCACTCAGACCAACTT AGG (reversed) Intronic
No off target data available for this crispr