ID: 1070944428

View in Genome Browser
Species Human (GRCh38)
Location 10:80377271-80377293
Sequence CCTCATGGGCTGCAGGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070944428_1070944434 22 Left 1070944428 10:80377271-80377293 CCATATGCCTGCAGCCCATGAGG No data
Right 1070944434 10:80377316-80377338 TCTGGCAGAAATGACCTCTCTGG No data
1070944428_1070944433 4 Left 1070944428 10:80377271-80377293 CCATATGCCTGCAGCCCATGAGG No data
Right 1070944433 10:80377298-80377320 AATGTGCTGTGTTTTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070944428 Original CRISPR CCTCATGGGCTGCAGGCATA TGG (reversed) Intergenic
No off target data available for this crispr