ID: 1070946292

View in Genome Browser
Species Human (GRCh38)
Location 10:80394718-80394740
Sequence GGCCCACTGAGTCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070946292_1070946299 27 Left 1070946292 10:80394718-80394740 CCAGCACAGTGACTCAGTGGGCC No data
Right 1070946299 10:80394768-80394790 TTAGGTGTGCCTGCTAATTGGGG No data
1070946292_1070946296 9 Left 1070946292 10:80394718-80394740 CCAGCACAGTGACTCAGTGGGCC No data
Right 1070946296 10:80394750-80394772 AGTTAAATGATTAATATTTTAGG No data
1070946292_1070946297 25 Left 1070946292 10:80394718-80394740 CCAGCACAGTGACTCAGTGGGCC No data
Right 1070946297 10:80394766-80394788 TTTTAGGTGTGCCTGCTAATTGG No data
1070946292_1070946298 26 Left 1070946292 10:80394718-80394740 CCAGCACAGTGACTCAGTGGGCC No data
Right 1070946298 10:80394767-80394789 TTTAGGTGTGCCTGCTAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070946292 Original CRISPR GGCCCACTGAGTCACTGTGC TGG (reversed) Intergenic
No off target data available for this crispr