ID: 1070949346

View in Genome Browser
Species Human (GRCh38)
Location 10:80418554-80418576
Sequence TCTCCCTTGCAGGACTTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 187}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070949346_1070949356 13 Left 1070949346 10:80418554-80418576 CCGGCCAAGTCCTGCAAGGGAGA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1070949356 10:80418590-80418612 TTCGATGGGCTGGGGTGAGGTGG No data
1070949346_1070949353 4 Left 1070949346 10:80418554-80418576 CCGGCCAAGTCCTGCAAGGGAGA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1070949353 10:80418581-80418603 AGTCAGAGGTTCGATGGGCTGGG No data
1070949346_1070949352 3 Left 1070949346 10:80418554-80418576 CCGGCCAAGTCCTGCAAGGGAGA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1070949352 10:80418580-80418602 GAGTCAGAGGTTCGATGGGCTGG No data
1070949346_1070949349 -10 Left 1070949346 10:80418554-80418576 CCGGCCAAGTCCTGCAAGGGAGA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1070949349 10:80418567-80418589 GCAAGGGAGACTTGAGTCAGAGG No data
1070949346_1070949354 5 Left 1070949346 10:80418554-80418576 CCGGCCAAGTCCTGCAAGGGAGA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1070949354 10:80418582-80418604 GTCAGAGGTTCGATGGGCTGGGG No data
1070949346_1070949357 14 Left 1070949346 10:80418554-80418576 CCGGCCAAGTCCTGCAAGGGAGA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1070949357 10:80418591-80418613 TCGATGGGCTGGGGTGAGGTGGG No data
1070949346_1070949350 -2 Left 1070949346 10:80418554-80418576 CCGGCCAAGTCCTGCAAGGGAGA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1070949350 10:80418575-80418597 GACTTGAGTCAGAGGTTCGATGG No data
1070949346_1070949351 -1 Left 1070949346 10:80418554-80418576 CCGGCCAAGTCCTGCAAGGGAGA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1070949351 10:80418576-80418598 ACTTGAGTCAGAGGTTCGATGGG No data
1070949346_1070949355 10 Left 1070949346 10:80418554-80418576 CCGGCCAAGTCCTGCAAGGGAGA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1070949355 10:80418587-80418609 AGGTTCGATGGGCTGGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070949346 Original CRISPR TCTCCCTTGCAGGACTTGGC CGG (reversed) Intronic
900802913 1:4748370-4748392 TCCCCCTTGCAGGTGCTGGCCGG - Intronic
901208699 1:7512325-7512347 TCCCCCTTACAGGCCTTGTCTGG - Intronic
903305387 1:22409265-22409287 TCTACCCCTCAGGACTTGGCAGG + Intergenic
905355484 1:37380861-37380883 TCTCCCGTGCCACACTTGGCAGG - Intergenic
905474141 1:38213964-38213986 TCTGCTCTGCAGGCCTTGGCTGG + Intergenic
906214940 1:44033223-44033245 TCTCCCTTCCAGCAGTAGGCTGG + Intergenic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
910436638 1:87212116-87212138 CTTCCCTTGCAGGACATGGCTGG + Intergenic
910665629 1:89723244-89723266 TCTCCCTTACAGTCCTTGGAAGG - Intronic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
915464023 1:156085498-156085520 TCTCCCTTTCAGGACTTTGGAGG + Intronic
917104897 1:171482680-171482702 TCTCCTTAGCAGCACTTGGATGG - Intergenic
917469449 1:175314086-175314108 TCTCCCATGCTGGAGTGGGCAGG - Intergenic
919453795 1:197800550-197800572 CCACCCTTGCAGGACTGGGCAGG + Intergenic
919917895 1:202150409-202150431 TCTCCAGTGCAGGGATTGGCCGG - Exonic
920577615 1:207073032-207073054 TGGCCCTTACAGGACCTGGCTGG - Exonic
921916035 1:220611371-220611393 TCTCCCGTGCCTGGCTTGGCGGG - Intronic
922622471 1:227000564-227000586 TCTACCTTACAGGACTTTGTGGG + Intronic
1062992398 10:1832685-1832707 TCCCCTCTGCAGGGCTTGGCTGG + Intergenic
1063138424 10:3236678-3236700 CTTCCCTTCCAGGCCTTGGCTGG + Intergenic
1063182719 10:3620100-3620122 TCTTTTTAGCAGGACTTGGCAGG - Intergenic
1066464108 10:35639006-35639028 CCTCCCTGGCTGCACTTGGCTGG - Exonic
1067551438 10:47239164-47239186 TGTCTCTTGCTGGACTTGCCAGG - Intergenic
1069614764 10:69800126-69800148 TTTCCCTTTCAGGACTTTGGAGG - Intergenic
1070949346 10:80418554-80418576 TCTCCCTTGCAGGACTTGGCCGG - Intronic
1072480565 10:95807306-95807328 TCTCCCGTGCCTGGCTTGGCGGG - Intronic
1073452873 10:103619896-103619918 CCTCCCTGGCAGGGCTAGGCAGG + Intronic
1074106647 10:110394039-110394061 TCGCCCCTGCAGGGCTTGGAGGG - Intergenic
1075581706 10:123623769-123623791 TCTCACTGGCAGGACATGGATGG - Intergenic
1077172937 11:1176445-1176467 TGTCCCTGGGAGGACCTGGCAGG + Intronic
1078283823 11:9930946-9930968 TCTCCCATGCCAGGCTTGGCTGG + Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1083431223 11:62614442-62614464 GAGCACTTGCAGGACTTGGCAGG + Exonic
1083713157 11:64560897-64560919 TCTACCTTGTAGGACAAGGCTGG - Intronic
1084067133 11:66711106-66711128 TCAGCCTTGGAGGACTGGGCAGG - Intronic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085345005 11:75762972-75762994 TCTTCCCTGCAGGAATTGGGGGG - Intronic
1088415621 11:109585973-109585995 TCTCCCTAGGAAGACATGGCAGG - Intergenic
1088693691 11:112348744-112348766 TCTCACTCCCAGGACCTGGCAGG - Intergenic
1089339673 11:117748936-117748958 TCTCCAGTGCAGAGCTTGGCGGG + Intronic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1090947023 11:131439605-131439627 TATCCCGTGCATGACTAGGCCGG - Intronic
1091167314 11:133491230-133491252 ACTCCCTTGCTGGGCTTGCCAGG + Intronic
1093414649 12:18906496-18906518 TCTCCCTTACAGGCCTTAGGAGG - Intergenic
1095706457 12:45242370-45242392 TCTCCCATGCCTGGCTTGGCAGG - Intronic
1096244308 12:49975704-49975726 CCTGCCTTGCAGGACCTGCCTGG + Exonic
1096570512 12:52520421-52520443 TATCCCTTCCAGAACTGGGCTGG + Exonic
1096881838 12:54679499-54679521 TCTCCCATGCAGACCTTGCCTGG + Intergenic
1101796159 12:107976167-107976189 TTTTCCTTGCAGAAATTGGCAGG - Intergenic
1102011983 12:109624424-109624446 TCTCCATAGCAGGCCTTGGACGG - Intergenic
1102592761 12:113969491-113969513 TCTCCCTTGGAGGTTTTGGAGGG + Intergenic
1104729656 12:131097907-131097929 TCTCCTTGGTTGGACTTGGCAGG - Intronic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105780671 13:23702789-23702811 TCTCCCCTGCAGGCTTGGGCCGG - Intergenic
1106816863 13:33418285-33418307 TCTCCCATGCCTGGCTTGGCAGG + Intergenic
1107461569 13:40608394-40608416 TCTCACTTTGAGGCCTTGGCTGG - Intronic
1110671989 13:78191428-78191450 TCTCCCTTCCAGAGATTGGCAGG + Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115747982 14:36458383-36458405 TGTCCCCTGCTGGTCTTGGCTGG - Intergenic
1118559891 14:67067750-67067772 TCTCCCATGCCTGGCTTGGCAGG - Intronic
1118603064 14:67483767-67483789 TCTCCATGGCAGGGCTGGGCCGG - Intronic
1121101155 14:91251278-91251300 TCTTTCTTGCAGGGCTTGGTGGG - Exonic
1121313472 14:92947426-92947448 ACTTCCTTGGAGGCCTTGGCTGG - Intronic
1121464253 14:94103988-94104010 TCAGCTTTGCAGAACTTGGCTGG - Intergenic
1121996684 14:98608279-98608301 TCTCCCTTCCAGGAGTGGGCAGG - Intergenic
1127179431 15:56399306-56399328 TCTCCCGTGCCTGGCTTGGCGGG + Intronic
1130739943 15:86588461-86588483 TCTCCCTTGCAGGACACAGCAGG - Intronic
1132154423 15:99485714-99485736 TCTGCTTTGCAGGTCTTGCCAGG + Intergenic
1132396811 15:101480545-101480567 CCTTCCTTGCAGGACTAGACAGG + Intronic
1132543949 16:524545-524567 TCTGCCTTGGGAGACTTGGCAGG - Intergenic
1133281532 16:4668253-4668275 TCTCCCCTGCAGCACATGGACGG + Exonic
1133422392 16:5657551-5657573 TTTCACTTGCTGGACTTGGAGGG + Intergenic
1133924871 16:10183919-10183941 TCTGCCTTTCAGGCCTTGGAAGG + Intergenic
1135134013 16:19874479-19874501 CCTCCATTGCAAGACGTGGCAGG + Intronic
1136061594 16:27730423-27730445 TCTCATTTGCAGTACTTGTCTGG + Intronic
1138475178 16:57266426-57266448 TCTCTCTTGGGGGACTGGGCTGG - Intronic
1138510125 16:57503920-57503942 GGTCCCTTGCAGGACAGGGCTGG - Intergenic
1138766655 16:59613365-59613387 TTTCTCTTGCAGGCCTGGGCAGG - Intergenic
1141353139 16:83317524-83317546 TCTTACTTGCAGCACTTGACTGG - Intronic
1141557861 16:84847751-84847773 GCTCCTTTGCAGCACCTGGCTGG + Intronic
1141620374 16:85234128-85234150 ACTCCCTTGCAGCACTAGGTGGG - Intergenic
1144641631 17:16940322-16940344 TCACCCTGGGAAGACTTGGCCGG + Exonic
1150418356 17:65006038-65006060 TCTCCCCTTCAGCAGTTGGCAGG + Intergenic
1151747128 17:76017758-76017780 ACACCCTTGGAGGACTTGGAGGG - Exonic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1152356372 17:79809670-79809692 TCTCCCTTCCACCACCTGGCTGG + Intergenic
1154370065 18:13752322-13752344 TCTCATTTGCAGGATATGGCTGG - Exonic
1156637645 18:39050436-39050458 TCTTCTTTTCAGGATTTGGCTGG - Intergenic
1158629023 18:59096032-59096054 TCTCCCTCGCAGGCCTTGGCAGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161655245 19:5510421-5510443 TCTCCGTTGCAGGACACGACAGG + Intergenic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1164377483 19:27701229-27701251 TATCCCTTGCATGGCTTGGAGGG - Intergenic
1164578192 19:29418343-29418365 TCTTACTTGCAGGACTTCTCAGG + Intergenic
1166165118 19:40982221-40982243 TCTCACCTGCAGGACTTCTCAGG - Intergenic
1166824638 19:45601337-45601359 CCTCTCTTCCAGGATTTGGCTGG - Intronic
929532628 2:42762314-42762336 TCTGCCTTTCAGGACATGCCGGG + Intergenic
929835108 2:45388950-45388972 TCTGCCTTGCTGGACTTGTATGG - Exonic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
932232533 2:70094595-70094617 TCTCACTGGCAGGAGGTGGCAGG - Intergenic
932508104 2:72256201-72256223 TCTCCCTTAGAGGATTTGGAGGG + Intronic
934318362 2:91947592-91947614 TATCCCTTGCATGGCTTGGCGGG + Intergenic
935565942 2:104607662-104607684 TATCCCGTGCATGGCTTGGCAGG + Intergenic
936153187 2:110032749-110032771 CCTCACCTGCAGGACATGGCGGG + Intergenic
936191494 2:110338666-110338688 CCTCACCTGCAGGACATGGCGGG - Intergenic
936925553 2:117732952-117732974 TTTCCCTTGTAGGACATGTCTGG - Intergenic
937992895 2:127674231-127674253 TCCCCCTGCCAGGACTTGGCTGG + Intronic
938042994 2:128091352-128091374 TCTCCCTTGCAGCCCATGCCCGG - Exonic
938206763 2:129430865-129430887 TCTGCCTTCCAGGCCTGGGCCGG + Intergenic
942245747 2:174006263-174006285 TCTCCCTTACAGGCCTTACCAGG - Intergenic
942958723 2:181804365-181804387 TCTCCCATGCCTGACTTGGCAGG - Intergenic
942987596 2:182161559-182161581 TCTCCCCTGCAGCAGTTGCCGGG + Intronic
948935589 2:241162237-241162259 ACACCACTGCAGGACTTGGCGGG - Intronic
1170582934 20:17712421-17712443 CTTGCCTTCCAGGACTTGGCAGG - Intronic
1171387720 20:24781355-24781377 ACTCCCTTGCGGGACTTTGTGGG - Intergenic
1172916515 20:38447507-38447529 TCTCCCTTGGATGGCTTTGCTGG + Intergenic
1176307438 21:5131230-5131252 TCTCCCTGGCAGGTCTTAGCCGG + Exonic
1179015900 21:37594342-37594364 TCTCACTTCCAGGACTTGTTAGG + Intergenic
1179632040 21:42684626-42684648 CCTCCTTTGCAGGACTCTGCTGG - Intronic
1179849622 21:44130800-44130822 TCTCCCTGGCAGGTCTTAGCCGG - Exonic
1180608587 22:17080757-17080779 TCTCACCTGCAGTGCTTGGCTGG - Intergenic
1183678336 22:39312271-39312293 TCTACCTTCTGGGACTTGGCTGG - Intergenic
1183805446 22:40206385-40206407 TCTCCCATGAAGGTCTTGTCAGG - Intronic
1183865679 22:40702351-40702373 TCTTCCTGGCCAGACTTGGCCGG - Intergenic
1184884912 22:47337446-47337468 TCTCCATTGAAGGACCTGGAGGG + Intergenic
952092193 3:29901278-29901300 TCTCCTTTTGAGAACTTGGCAGG - Intronic
954411201 3:50371971-50371993 TCCCCTTTGCTGGACTAGGCTGG + Intronic
954645073 3:52126282-52126304 TTTCCCTCCCAGAACTTGGCTGG - Intronic
960787698 3:121392198-121392220 TCTCCCATGCCTGGCTTGGCAGG - Intronic
961106130 3:124243214-124243236 CCACCATTGTAGGACTTGGCAGG + Intronic
961222498 3:125212044-125212066 TCTACCTTGCAGCACTGTGCTGG - Intronic
961436046 3:126917376-126917398 TGTCCCTTGCAGGCCCTGCCTGG + Intronic
962291447 3:134140198-134140220 TCTCCCGTGCCTGACTCGGCAGG + Intronic
963159990 3:142141165-142141187 TCTCCCGTGCCTGGCTTGGCGGG - Intronic
963273005 3:143303786-143303808 TTTCCCTTGCAAAACTTGCCAGG + Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
966351789 3:179038907-179038929 TCTCCCGTGCCTGGCTTGGCAGG + Intronic
967851749 3:194087849-194087871 TCTCCTTTCCAGGACTTTGTGGG - Intergenic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
973884151 4:55303816-55303838 GCACCCTGGCAGGACTTGGAGGG - Intergenic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
974954265 4:68619076-68619098 TCTCCCGTGCCTGACTTGGGGGG + Intronic
975751111 4:77524516-77524538 TCTCCCATGCCTGGCTTGGCAGG - Intronic
978928938 4:114287357-114287379 TCTCCCGTGCCTGACTTGACAGG + Intergenic
981512678 4:145574664-145574686 TCTCCCATGCCTGGCTTGGCAGG + Intergenic
985520142 5:370409-370431 TCTCCCGTCCAGGAGTTGGATGG - Intronic
985717553 5:1471207-1471229 TCTCAAATGCAGGTCTTGGCAGG - Intronic
986543310 5:8870037-8870059 TCCCGCTTGCAGGACGTGCCAGG + Intergenic
991610486 5:68444893-68444915 TCACACTTACAGGATTTGGCAGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993653672 5:90552603-90552625 TCTCCCTTGCAGTCCTTCTCTGG + Intronic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
1001780539 5:174365200-174365222 TTTCCATTACAGGACCTGGCTGG - Intergenic
1002450295 5:179314837-179314859 TGTCCCTTGCAGCTCTTGGTTGG - Intronic
1006392046 6:33764250-33764272 TCTCCCTTGCAAGTCTGGCCTGG - Intergenic
1009988122 6:70806304-70806326 TCTCCCGTGCCTGGCTTGGCAGG - Intronic
1010755694 6:79663964-79663986 TCTCCCATGCCTGGCTTGGCAGG - Intronic
1012406420 6:98905425-98905447 TCTCTGTTGCAGGATTTAGCAGG - Exonic
1012589972 6:100969037-100969059 TCTCCCTTGCTGGGCTCGGTGGG + Intergenic
1014936589 6:127392580-127392602 TCTTTCCTGCAGGACCTGGCTGG + Intergenic
1017603857 6:156112152-156112174 GCTCCCTCGCACTACTTGGCTGG + Intergenic
1017908917 6:158776241-158776263 TCTCCCCTGCAGCAATTGCCTGG + Intronic
1019607292 7:1916611-1916633 ACTCCCTTGCAGGGCCTGGAGGG - Intronic
1020818806 7:12939895-12939917 TATCCCGTGCATGGCTTGGCGGG - Intergenic
1023307561 7:38847100-38847122 TCCCACTGGCAGGACTTGGCTGG + Intronic
1029266354 7:99344281-99344303 TCTCACTTGCAGGTATTGACTGG + Exonic
1031905040 7:127451284-127451306 TCTCCCGTGCCTGGCTTGGCGGG + Intergenic
1032671265 7:134084610-134084632 TCTACCTTGCAAGGCCTGGCAGG + Intergenic
1034904320 7:154930511-154930533 TCTGCTTTCCAGGACTTGGGAGG - Intronic
1034999866 7:155604060-155604082 CCTCCCTTGCAGTATTTGGACGG - Intergenic
1035751323 8:1998782-1998804 TCTCCTTTGCATGACTCAGCTGG + Intronic
1036440559 8:8778013-8778035 TCTTCCTTGCAAGACCTTGCAGG + Intergenic
1036686839 8:10917374-10917396 TCCACCATGCAGCACTTGGCAGG - Intronic
1036998440 8:13688105-13688127 TCTCCCTTGCAGGTCTTTGGAGG - Intergenic
1037061712 8:14520121-14520143 TATACCTTAGAGGACTTGGCAGG - Intronic
1037134415 8:15444893-15444915 CCTCCCTTCCAGGAGTTTGCCGG - Intronic
1041815759 8:61968846-61968868 TCTCCCGTGCCTGCCTTGGCAGG - Intergenic
1041909852 8:63077506-63077528 TCTCCTGTGCATGGCTTGGCGGG + Intronic
1044615629 8:94137436-94137458 TCTCCCGTGCCTGGCTTGGCAGG - Intronic
1047864073 8:129002435-129002457 TCACCCTTGCATGATTAGGCAGG + Intergenic
1048149813 8:131883551-131883573 TATCCCGTGCATGGCTTGGCAGG - Intergenic
1048160684 8:132018229-132018251 TCTCCCTGGCAGGACTTTTCAGG + Intergenic
1048231310 8:132644684-132644706 TATCCCATGCATGACTTGGAGGG + Intronic
1049081635 8:140447792-140447814 TCTCCCCTGCAGCTCTTGGTAGG - Intronic
1049176180 8:141194021-141194043 TCTCCCTGGCAGGTCTGGGTGGG + Exonic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1050846708 9:10230193-10230215 CCTCCCTTGCAGTCCTTGGAAGG + Intronic
1050855816 9:10353512-10353534 TCTCCCATGCAGAGGTTGGCAGG - Intronic
1051250882 9:15157562-15157584 TCACCCTTGTGGGACTTGGCAGG + Intergenic
1052204010 9:25816104-25816126 TTTCTCTTGCAGGACTTTGCTGG + Intergenic
1053510726 9:38686005-38686027 TCTCCCATGCATGATTTGACAGG + Intergenic
1057696988 9:97330142-97330164 TTTTCCTTGTAGAACTTGGCTGG + Exonic
1058429714 9:104907353-104907375 GCTCCCTAGGAAGACTTGGCTGG + Intronic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059424266 9:114210970-114210992 TCTCCCCTGCAGGGCCTGCCTGG + Exonic
1186194697 X:7098858-7098880 TCTCCCCTGCATCTCTTGGCCGG - Intronic
1186194703 X:7098882-7098904 TCTCCCCTGCATCTCTTGGCCGG - Intronic
1186194709 X:7098906-7098928 TCTCCCCTGCATCTCTTGGCCGG - Intronic
1186194715 X:7098930-7098952 TCTCCCCTGCATCTCTTGGCCGG - Intronic
1189521069 X:41768770-41768792 TCTCCCTTGCTTGCCTAGGCTGG - Intronic
1189605785 X:42676390-42676412 TCTCCCTTGCGGGAGTTGCCAGG + Intergenic
1191043236 X:56107516-56107538 TCTCCAGTGCCGGGCTTGGCGGG - Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1196094513 X:111784767-111784789 TCTCCCGTGCCTGGCTTGGCAGG + Intronic
1199978383 X:152907508-152907530 TGTCCCTGGCAGGGCTGGGCGGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic