ID: 1070950647

View in Genome Browser
Species Human (GRCh38)
Location 10:80428320-80428342
Sequence CAGTGTCAGCAGAGGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070950635_1070950647 11 Left 1070950635 10:80428286-80428308 CCTTGAGCCATGGTGGTTCCCCT No data
Right 1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG No data
1070950640_1070950647 -7 Left 1070950640 10:80428304-80428326 CCCCTGCCCTGGAGGGCAGTGTC 0: 1
1: 0
2: 4
3: 33
4: 390
Right 1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG No data
1070950636_1070950647 4 Left 1070950636 10:80428293-80428315 CCATGGTGGTTCCCCTGCCCTGG 0: 1
1: 0
2: 1
3: 35
4: 384
Right 1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG No data
1070950641_1070950647 -8 Left 1070950641 10:80428305-80428327 CCCTGCCCTGGAGGGCAGTGTCA 0: 1
1: 0
2: 4
3: 33
4: 404
Right 1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG No data
1070950642_1070950647 -9 Left 1070950642 10:80428306-80428328 CCTGCCCTGGAGGGCAGTGTCAG 0: 1
1: 0
2: 2
3: 60
4: 800
Right 1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070950647 Original CRISPR CAGTGTCAGCAGAGGCCAGG AGG Intronic
No off target data available for this crispr