ID: 1070951481

View in Genome Browser
Species Human (GRCh38)
Location 10:80434910-80434932
Sequence ATGTCCTCTAAGAAGAGGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070951477_1070951481 20 Left 1070951477 10:80434867-80434889 CCAAAGGGACAGAAAGGATTTAC 0: 1
1: 0
2: 2
3: 13
4: 173
Right 1070951481 10:80434910-80434932 ATGTCCTCTAAGAAGAGGGAGGG 0: 1
1: 0
2: 4
3: 33
4: 258
1070951474_1070951481 23 Left 1070951474 10:80434864-80434886 CCCCCAAAGGGACAGAAAGGATT 0: 1
1: 0
2: 1
3: 20
4: 195
Right 1070951481 10:80434910-80434932 ATGTCCTCTAAGAAGAGGGAGGG 0: 1
1: 0
2: 4
3: 33
4: 258
1070951476_1070951481 21 Left 1070951476 10:80434866-80434888 CCCAAAGGGACAGAAAGGATTTA 0: 1
1: 0
2: 1
3: 19
4: 332
Right 1070951481 10:80434910-80434932 ATGTCCTCTAAGAAGAGGGAGGG 0: 1
1: 0
2: 4
3: 33
4: 258
1070951475_1070951481 22 Left 1070951475 10:80434865-80434887 CCCCAAAGGGACAGAAAGGATTT 0: 1
1: 0
2: 1
3: 36
4: 280
Right 1070951481 10:80434910-80434932 ATGTCCTCTAAGAAGAGGGAGGG 0: 1
1: 0
2: 4
3: 33
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070951481 Original CRISPR ATGTCCTCTAAGAAGAGGGA GGG Exonic
900197368 1:1383374-1383396 ATGTCCACCAGCAAGAGGGAGGG + Intergenic
901850686 1:12012926-12012948 ATTTCCTCAAAGATGAGTGATGG - Exonic
903603345 1:24557617-24557639 ATGTCCTCTAAGTGGGGAGAGGG + Intronic
904497014 1:30892777-30892799 TTGTCCTCTATGAAGCTGGAGGG - Intronic
906116914 1:43363318-43363340 CTGTCCACAAACAAGAGGGATGG - Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
908339653 1:63163549-63163571 AAGTCCTAGAAGATGAGGGAAGG - Intergenic
909474850 1:76071475-76071497 AAGGCCTCTGAGGAGAGGGAAGG + Intergenic
910994756 1:93092495-93092517 ATTGCCTCTAAGGAGTGGGAAGG - Intronic
911199402 1:95029328-95029350 AAGTGCTCCAAGAAGAGGCAAGG + Intronic
911230850 1:95360057-95360079 ATGACATCTAAGAAGAGGCAGGG - Intergenic
911442866 1:97950666-97950688 ATGTCCTCTCAAAGGAGGAAGGG + Intergenic
913074487 1:115330189-115330211 ATGTCCTCTTGCCAGAGGGATGG - Intronic
915559026 1:156675861-156675883 GTCTCCTCTGAGAGGAGGGATGG + Intronic
915737254 1:158092981-158093003 CTGACCTCAAAGAAGAGCGAGGG + Intronic
915940828 1:160117273-160117295 AGGACCTCTGAGAAGAGGCAGGG + Intronic
916737756 1:167623085-167623107 AGGTACTCTAAGAAAAGGGCTGG - Intergenic
917645510 1:177025106-177025128 ATGCCCTCTGTGAAGAGCGATGG - Intronic
917910534 1:179640162-179640184 ATATGCACTAAGAAGAAGGAAGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919448843 1:197745485-197745507 ATGTGTTCTAACAAGAGAGATGG - Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
924225966 1:241921865-241921887 ATGACCTGTAAGAAGAGGGGTGG + Intergenic
1062972261 10:1657683-1657705 ATGTCCTCTAAGCCGAGCGCAGG + Intronic
1063607294 10:7533874-7533896 TTGTCCTCTGTGAAGTGGGAGGG - Intergenic
1063810772 10:9704126-9704148 ATGTCCTCTAAAAAGAAGATTGG + Intergenic
1064164528 10:12974732-12974754 ATGTGCTCTAAGAAGACCCAAGG - Intronic
1070951481 10:80434910-80434932 ATGTCCTCTAAGAAGAGGGAGGG + Exonic
1071549864 10:86558389-86558411 ATTTCCAATAAGAAAAGGGAAGG - Intergenic
1071726725 10:88205784-88205806 ATATTCTCAAAGCAGAGGGATGG - Intergenic
1073193544 10:101669474-101669496 ATGTCCTCCACGGAAAGGGAAGG + Intronic
1073630861 10:105147599-105147621 ATGTCCTGAAAGAAGATGGAAGG - Exonic
1074411895 10:113235689-113235711 AGTTCCTTTAACAAGAGGGATGG + Intergenic
1074625994 10:115187326-115187348 ATGCCATCTAAAAAGAGGGATGG + Intronic
1074669890 10:115778308-115778330 ATGGCCTATTAGAAGAGGTAAGG + Intronic
1075145077 10:119875759-119875781 CTGTCCTCCAGGAAGAGGGAGGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078579758 11:12529301-12529323 AAGTCCTGTAAGAATAGGGAAGG + Exonic
1080604001 11:33848949-33848971 ATGTCGTTTTAGAGGAGGGAGGG - Intergenic
1081527537 11:43936890-43936912 AGGGCCTCTTAGAAGAGGGCAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084327626 11:68410969-68410991 ATCTGCTAAAAGAAGAGGGAAGG + Intronic
1084682937 11:70677643-70677665 ATGACCTCCAAGAAGCGGGCAGG + Intronic
1086399199 11:86447025-86447047 ATGTCCTCTCAGCCGGGGGAAGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088588682 11:111381614-111381636 CTGTCCTCTGGAAAGAGGGAAGG + Intronic
1088968491 11:114749999-114750021 ATGTCCTCTTGGAGGAGGGCAGG - Intergenic
1089785023 11:120901524-120901546 ATGACCTCTAATAAGAGAAATGG - Intronic
1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091015094 11:132043393-132043415 ATTTCAGCTAAGATGAGGGAGGG + Intronic
1092748373 12:11694757-11694779 ATGTCTTCTAAAGAGAGAGATGG - Intronic
1094603180 12:31928418-31928440 ATATCCTCAAAGAAGAGTCAGGG - Intergenic
1096079264 12:48823022-48823044 ATGTCCTCTGAGCCGAGGGAAGG - Intronic
1096346545 12:50852319-50852341 ATATGCTCAAAGTAGAGGGATGG + Intronic
1096949310 12:55448772-55448794 ATGTACTGGAAAAAGAGGGAGGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097554996 12:61125638-61125660 GTATCCTCTTAGAAGAGAGATGG - Intergenic
1097812831 12:64036911-64036933 CTGTCCTGTAAGAAGAGCCAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102486422 12:113260760-113260782 GTGTGCCCTGAGAAGAGGGAGGG - Intronic
1103971216 12:124674049-124674071 ATGACCTCAAGGAAGAGGAACGG + Intergenic
1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG + Intergenic
1107960042 13:45549318-45549340 ATGACCACTTAGAAGAGGGAGGG + Intronic
1109054223 13:57526542-57526564 AATTGCTCTAAGAAAAGGGAGGG - Intergenic
1111044954 13:82802923-82802945 AAGTGCTCTAAGAACAGGGAGGG + Intergenic
1111570018 13:90072251-90072273 ATGACAGCAAAGAAGAGGGAAGG - Intergenic
1112418320 13:99224250-99224272 ATGTCTTTTAAGAAAAGGGAGGG - Intronic
1115125594 14:29989227-29989249 ATGTCCTTGAATCAGAGGGATGG - Intronic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116007194 14:39306786-39306808 AACTCCTCTAAGATGAAGGAAGG - Intronic
1117494515 14:56289450-56289472 CTGTGCTCTAAGAAGAGACAAGG - Intronic
1118931339 14:70244146-70244168 ATGTCCTCTAGGAATAGAGATGG - Intergenic
1118953829 14:70460980-70461002 ATGTCCTCTAGGAATAGAGATGG + Intergenic
1120088517 14:80304128-80304150 ATGGCTTCTATGAAGAGAGAAGG + Intronic
1120763028 14:88303114-88303136 ATGTCGTCTAAAAGCAGGGAAGG - Intronic
1120838265 14:89060485-89060507 ATGTATTCTTAGAAGAGGGAGGG - Intergenic
1121884697 14:97532782-97532804 CTGTCCTCTATGAAGAGGAAAGG - Intergenic
1121990818 14:98555234-98555256 ATGTGCTCTATGATTAGGGAAGG + Intergenic
1124691743 15:31829187-31829209 CTGTCCTCCAAGGAGAGGGAGGG - Intronic
1125072940 15:35577572-35577594 ATGTCATCTAAGGACAGGGATGG + Intergenic
1125987348 15:44067022-44067044 AAGTCCAAGAAGAAGAGGGATGG + Intronic
1128183737 15:65626488-65626510 ATGGCGTCTGAGAAGGGGGAGGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1130458107 15:84135094-84135116 ATGTACTCTTTGAAGATGGAGGG - Intergenic
1130797539 15:87225937-87225959 ATGGCCTCAGAGAAGAAGGAAGG + Intergenic
1131987389 15:98058132-98058154 ATGTCATCTACAAAGAAGGATGG + Intergenic
1132633585 16:931661-931683 ATGTTCTCCAAGATCAGGGAAGG + Intronic
1135747654 16:25031050-25031072 ATGACCTCTAGGGAGTGGGACGG - Intergenic
1135774726 16:25246931-25246953 ATGTCCTCAAAGAAGGCGCAGGG + Exonic
1136746192 16:32594298-32594320 ATGGCCTCTATGAAGGTGGATGG - Intergenic
1138376635 16:56568758-56568780 ACTTCCTCTAAGTAGTGGGAGGG + Intronic
1139323609 16:66134780-66134802 ATGTCATCTGAGAAGAGGGATGG + Intergenic
1140303667 16:73782524-73782546 ATGTTCTCTAAGGGGAAGGATGG - Intergenic
1203048321 16_KI270728v1_random:853502-853524 ATGGCCTCTATGAAGGTGGATGG - Intergenic
1142906401 17:3045315-3045337 ATGTAGACTAAGAAGTGGGAGGG - Intergenic
1143809942 17:9463045-9463067 TGGTCTTCTAAGAAGAGGGGAGG + Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1144918912 17:18747231-18747253 ATCTGCTCTAAGAAAAGAGAAGG - Intronic
1145061177 17:19735103-19735125 AGGTGCTCTAAGACAAGGGAAGG + Intergenic
1145989496 17:29070419-29070441 ATGTCCTAGGAGAAGATGGAAGG + Intergenic
1147456706 17:40542492-40542514 ATTTCCAGTAAGAAGTGGGAGGG - Intergenic
1147620024 17:41860068-41860090 ATGTTCTCTTAAAAGAGTGAAGG - Intronic
1148229214 17:45920733-45920755 ATGTCCTCTATGGTTAGGGACGG - Intronic
1148537920 17:48456179-48456201 ATGTCTTCCAGGAACAGGGAAGG - Intergenic
1148745842 17:49917677-49917699 AGGTCCTCAAAGCAGAGGGATGG - Intergenic
1149239654 17:54634232-54634254 AAGTCTTTTAAGAAGATGGAGGG + Intergenic
1149651918 17:58280964-58280986 ATGTCCTCTAAGCTGGGGGTGGG + Intergenic
1150831114 17:68520120-68520142 CTGTTCTCAAAGCAGAGGGAGGG + Intronic
1155191982 18:23438291-23438313 ATGTTCACTTAAAAGAGGGAAGG + Intergenic
1155559501 18:27060690-27060712 ATGTCATGTGAGAAGAGGGTTGG - Intronic
1156735573 18:40254349-40254371 ATGTCCTCAAATTAAAGGGATGG - Intergenic
1157244290 18:46039911-46039933 CTGTCCTCTCTGAAGAGGGTGGG - Intronic
1158696523 18:59708848-59708870 AGGCCCTATAAGAAGAAGGAAGG - Intergenic
1159033748 18:63257797-63257819 ATGTCCTTTAAGTGGAGGGACGG + Intronic
1160012472 18:75116512-75116534 CTGTCCTGGAAGAAAAGGGAGGG + Intergenic
1160353432 18:78205383-78205405 ATGTTCTCTAAGAAGATGGAAGG + Intergenic
1161057907 19:2199897-2199919 ATTTCCTCTCAGAAGAGTGGAGG + Exonic
1161612289 19:5250208-5250230 GTGTGCTCTAGGAAGAGGGCTGG + Intronic
1162519813 19:11173228-11173250 GGGTCCTCTGAGAAAAGGGAGGG - Intronic
1163149236 19:15401289-15401311 ATGTTCTGGGAGAAGAGGGAGGG + Exonic
1163270157 19:16248295-16248317 ATGTCCTGTGAGGAGGGGGAAGG - Intergenic
1163580452 19:18135724-18135746 ATCTCATCTAAAATGAGGGAGGG - Exonic
1164404689 19:27934200-27934222 TTGTCCTCAAAGAATAGAGAAGG - Intergenic
1164829623 19:31310501-31310523 ATCTCCTTTAAGAAGGTGGAAGG - Intronic
926126062 2:10272557-10272579 ATGTCCTTTAAGAAGAGATTAGG + Intergenic
927009997 2:18893515-18893537 ATGTCCGCTAGAAAGAGGGAGGG + Intergenic
928082235 2:28321659-28321681 ATGTGCTCTTGGCAGAGGGAGGG + Intronic
929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG + Exonic
930062116 2:47298833-47298855 ATGACTTCTTAGACGAGGGAAGG + Intergenic
930509001 2:52321202-52321224 ATGGCATCTAAGAAAAAGGAAGG - Intergenic
932080233 2:68707545-68707567 ATGTGCTCCAGGAAGAGAGAAGG - Intronic
937683234 2:124667003-124667025 ATGTGCTTTAAGAAGAACGATGG + Intronic
938193877 2:129308963-129308985 ATGTCCTCTGTGAACACGGAGGG + Intergenic
938588901 2:132718627-132718649 GTGTCCTCAAAGAAGAAGAAAGG + Intronic
939936139 2:148296230-148296252 ATATTCTATAAGAAGAGAGAAGG - Intronic
940099315 2:150015966-150015988 AGGTCCACTCACAAGAGGGAGGG + Intergenic
943080647 2:183255079-183255101 CCGTCGTCTAACAAGAGGGAGGG + Intergenic
943649630 2:190442895-190442917 TTGTCGTCTAAGAAGAGAAATGG + Intronic
943807551 2:192141091-192141113 ATGTCCTCTAAGAACCGAGAGGG + Intronic
944013859 2:195008349-195008371 ATGTCCTGCAAGAATAGGAAAGG - Intergenic
944268805 2:197758974-197758996 ATGTCATACAAGAAGATGGATGG - Intronic
944467094 2:200013068-200013090 ATGCTCTCTAAGAAGGGGTATGG + Intergenic
944756136 2:202763905-202763927 GTGGCCTGTAGGAAGAGGGAGGG - Intronic
944817621 2:203394384-203394406 AACTCTTCTAAGAAGAGGTAGGG + Intronic
944845231 2:203661545-203661567 ATGTTCTCTAAGGAGAGGCTGGG + Intergenic
945811826 2:214558266-214558288 ATGTCCTGCAAGAAGAAAGAGGG - Intronic
947067428 2:226244205-226244227 ATATCCTCCATGAAGAAGGAGGG + Intergenic
947397867 2:229704055-229704077 ATTTCATCAAAGAAGAGGCATGG + Intronic
948725506 2:239931339-239931361 GTGTCATCGAAGGAGAGGGAGGG - Intronic
948742951 2:240060202-240060224 CTGTCTTCAAATAAGAGGGACGG - Intergenic
1169695037 20:8377740-8377762 ATGTCCTCAGATAAGAAGGAAGG + Intronic
1173732589 20:45339052-45339074 ATGACCTCTGACAAGAGGGAAGG + Intronic
1174462654 20:50693732-50693754 ATGTCCCCAAAGAAGATAGATGG - Intergenic
1174706226 20:52658992-52659014 ATCTCCTCTAAGTTGAAGGAAGG + Intergenic
1175360354 20:58405349-58405371 ATGAGCTCAAAGAAGAGGGCAGG + Intronic
1176525042 21:7859660-7859682 AAATACTCTAAGAAAAGGGAGGG - Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1178659062 21:34489673-34489695 AAATACTCTAAGAAAAGGGAGGG - Intergenic
1181004348 22:20003923-20003945 ATGTCGTCTATGAACAGAGATGG - Intronic
1182011337 22:27003217-27003239 ATTTCCAATAAAAAGAGGGAGGG - Intergenic
1182203022 22:28592809-28592831 TTGTGCTCTAAGAAAAGGGTAGG - Intronic
1182853304 22:33495179-33495201 AAGTGTTCTAAGCAGAGGGAAGG - Intronic
1183423617 22:37725950-37725972 AGGTCCTGGAATAAGAGGGAAGG - Exonic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951944690 3:28122287-28122309 ATATCATGAAAGAAGAGGGAAGG - Intergenic
952539479 3:34352493-34352515 AAGTCCTCTAATAAGGGTGAAGG - Intergenic
952809718 3:37391020-37391042 ATGTCCTCTGCAAACAGGGAGGG + Intronic
954098598 3:48351769-48351791 AAATGCTCTAAGAAAAGGGAAGG + Intergenic
955521022 3:59775811-59775833 ATGGCCTCTGAGAGGATGGATGG + Intronic
958134342 3:89468132-89468154 ATGTCCTCTCTGAGGAGGAAAGG + Intronic
958180974 3:90060625-90060647 TTGTCCTCTAGGCAGGGGGAAGG + Intergenic
959389168 3:105752540-105752562 ATGTTATCTTATAAGAGGGACGG - Intronic
961307026 3:125965237-125965259 AGGGCCTCTTAGAAGAAGGAAGG + Intergenic
961608049 3:128112343-128112365 ATCTCCCCTCAGAGGAGGGAAGG + Intronic
961909931 3:130303891-130303913 AAATACTCTAAGAAAAGGGATGG + Intergenic
962056105 3:131873424-131873446 ATCAAATCTAAGAAGAGGGAGGG - Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963581518 3:147131677-147131699 ATGTCCACTGAGAAGAGGTTGGG + Intergenic
964488180 3:157207165-157207187 ATGGCATCTAAGCAGAGAGAGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966694042 3:182771084-182771106 ATGATCTCTCACAAGAGGGATGG + Intergenic
967274470 3:187760489-187760511 AGGTGCTATAAGATGAGGGAAGG + Intergenic
968019258 3:195369565-195369587 ATGTCCTGTAGGAACATGGATGG - Intronic
970073472 4:12190445-12190467 AAATGCTCTAAGAAAAGGGAGGG + Intergenic
971091506 4:23351224-23351246 AGTTCCTCTAAGAAATGGGAAGG + Intergenic
971135048 4:23859424-23859446 ATGTATTCAAAGAAGAGGGAAGG + Intronic
972217756 4:36916335-36916357 AAATGCTCTAAGAAAAGGGAGGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973658491 4:53076818-53076840 TTGTTCTCAAAGAAGAGGGAAGG - Intronic
973669808 4:53205054-53205076 ATGTCCTCTAAAAAACAGGAGGG + Intronic
974146081 4:57949067-57949089 CTGTCCTCAAGGGAGAGGGAAGG - Intergenic
977003634 4:91536542-91536564 ATTTCCACTAAGAAGAAAGAGGG + Intronic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
980967221 4:139533912-139533934 ATGTCTTCCAAGGAGATGGAAGG - Intronic
981292989 4:143098000-143098022 ATGTGCTCCAGGAAGAGGGAAGG - Intergenic
982322134 4:154088167-154088189 ATGTCCCCTAAGAGGGAGGAAGG - Intergenic
983115667 4:163812977-163812999 ATGTCAGCTCAGAAGAGGTAGGG + Intronic
983258355 4:165427768-165427790 ATCTCCTCTAGCAATAGGGAAGG + Intronic
983966266 4:173815639-173815661 ATGTCATCTACAAAGAGAGATGG - Intergenic
986968539 5:13304377-13304399 AAGTGCTCTAAGAAAAGGAAAGG + Intergenic
987758445 5:22127158-22127180 ATGAGCTATAAGAAGAGAGAAGG + Intronic
988785796 5:34564543-34564565 ATTTTCTCTAAGCAGAGTGATGG - Intergenic
988908654 5:35816868-35816890 AACTCCTCTAAGCAGTGGGATGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990486597 5:56265349-56265371 ATGTACTTTGAGAAGAGGGCAGG - Intergenic
990740476 5:58907592-58907614 ATGTATTCTGATAAGAGGGAGGG + Intergenic
990830483 5:59951721-59951743 ATGGCTTCTATGTAGAGGGAGGG - Intronic
991749202 5:69781295-69781317 ATGAGCTATAAGAAGAGAGAAGG + Intergenic
991800783 5:70361106-70361128 ATGAGCTATAAGAAGAGAGAAGG + Intergenic
991827817 5:70648935-70648957 ATGAGCTATAAGAAGAGAGAAGG - Intergenic
991893146 5:71360547-71360569 ATGAGCTATAAGAAGAGAGAAGG + Intergenic
992215594 5:74521920-74521942 ATGTCAGCTAGGAAGAGTGAAGG + Intergenic
992356193 5:75986368-75986390 ATGTGCTCTGAGAAGAGAAAGGG + Intergenic
993946807 5:94124767-94124789 CTGCCCTTGAAGAAGAGGGATGG + Intergenic
994040378 5:95252512-95252534 AAATGCTCTAAGAAAAGGGAAGG + Intronic
995991061 5:118240211-118240233 CTGTCCTCTAACAGGAGTGATGG - Intergenic
996727992 5:126689264-126689286 ATTTCATCTAAAAAGAGGGGTGG + Intergenic
997754361 5:136382294-136382316 AAATGCTCTAAGAAAAGGGAAGG + Intronic
999815005 5:155167329-155167351 CTGTGATCTCAGAAGAGGGAAGG + Intergenic
1000857152 5:166412785-166412807 ATATTTTCTGAGAAGAGGGAAGG + Intergenic
1001857429 5:175025152-175025174 TTGTCCTTTAGGAACAGGGAAGG - Intergenic
1003397631 6:5766569-5766591 ATGTCCTCTAAGAAGTGACAAGG - Intronic
1003461818 6:6335961-6335983 TTGTCCTTTAAAAAGATGGAAGG + Intergenic
1003543806 6:7041436-7041458 ATGTCCTCTATGAGGAGCCAAGG + Intergenic
1004722393 6:18278340-18278362 AGGTCCGCAAAGAAGAGAGAGGG + Intergenic
1005137368 6:22585272-22585294 ATGTCCTCTACAAATATGGATGG + Intergenic
1007296709 6:40828451-40828473 ATGTCATCTACAAATAGGGATGG - Intergenic
1007561566 6:42813133-42813155 TAGTCCCCAAAGAAGAGGGAGGG + Intronic
1010509742 6:76703782-76703804 AAGTGCTCTAAGAAAAAGGAGGG - Intergenic
1013468131 6:110435296-110435318 GTGTCTTATATGAAGAGGGAGGG + Intronic
1017088191 6:150734178-150734200 ATGTCTTCTAAGAGGCGGAAGGG + Intronic
1018469822 6:164085449-164085471 ATGCCCTCAAAGAAGCTGGAAGG + Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020898751 7:13975637-13975659 AGGTCCACAAAGAGGAGGGAAGG + Intronic
1022448419 7:30490458-30490480 ATGTCATCTGAAAATAGGGATGG + Intergenic
1022743185 7:33142928-33142950 ATATCCACCAAGAAGTGGGATGG + Intronic
1023458685 7:40369594-40369616 CTGGCCCCTAAGAAGGGGGAGGG + Intronic
1024476738 7:49819897-49819919 ATGTCCTATAAATAGAGGGAGGG + Intronic
1025852349 7:65253801-65253823 ATCTCTTCTAAAAAGATGGATGG - Intergenic
1026392397 7:69914649-69914671 ATTACCTCTAAAAAGATGGAAGG - Intronic
1026436790 7:70406224-70406246 ATGTCCTCTGAGAGGAGGGAGGG - Intronic
1026970769 7:74466175-74466197 CTGGCCTCTAACAAGCGGGATGG - Intronic
1027894783 7:84026687-84026709 ATGTCCTGTAGGAACATGGATGG + Intronic
1028217807 7:88156581-88156603 ATCTACTTTAGGAAGAGGGAGGG + Intronic
1028800553 7:94960364-94960386 GTGTCCTCTATGCTGAGGGAGGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1031098431 7:117448594-117448616 CTCTCCTCTAAGCAGAAGGAAGG - Intergenic
1032371193 7:131354559-131354581 ATGTCATCTGAAAATAGGGATGG + Intronic
1032509758 7:132463353-132463375 ATGTGCTCTAAGAATACTGAGGG - Intronic
1034315595 7:150128610-150128632 ATGTGCTCTAGGAGGAGTGAAGG - Intergenic
1034791294 7:153972195-153972217 ATGTGCTCTAGGAGGAGTGAAGG + Intronic
1034990089 7:155542653-155542675 ATGTCCTCTCAGCAGCGGGAGGG - Intergenic
1036578719 8:10053666-10053688 AGGTCGTCTCAGATGAGGGAGGG - Intergenic
1037340222 8:17836586-17836608 ATGTCTTCTAACAAAAGGAATGG + Intergenic
1037695899 8:21223684-21223706 ATGTCCTGGAAGATGAGGTATGG + Intergenic
1038514209 8:28170475-28170497 ATGTCCTCACGGAAGAGAGATGG - Intronic
1038769873 8:30467482-30467504 ATGGTCTGTCAGAAGAGGGATGG + Intronic
1039160107 8:34608608-34608630 ATGTCCTCTAAGATAATAGAAGG + Intergenic
1039870455 8:41540948-41540970 ATGTCCTCACAGAGAAGGGAAGG + Intronic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1041118865 8:54566457-54566479 GTGTCATCTGAGAAGAGTGAAGG + Intergenic
1042226951 8:66521605-66521627 ATGTCCTCCATGAAGAAGAAGGG + Intergenic
1043767261 8:84151551-84151573 ATGTTCTCTAAGAAAAAGGAGGG - Intergenic
1044780756 8:95741098-95741120 CCTTCCTCTAAGAAGAGGCAAGG - Intergenic
1044930071 8:97244033-97244055 ATATCCTTTGAGAAGAGGGTTGG - Intergenic
1048412140 8:134186138-134186160 ATATCCCCCAAGGAGAGGGAGGG - Intergenic
1049791521 8:144474690-144474712 GAGGCCTCTCAGAAGAGGGAAGG + Exonic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052397540 9:27958022-27958044 TTGTCCTCTAAGATTAGGAAAGG - Intronic
1055465517 9:76561618-76561640 ATGACCTCCAGGAAGAGAGATGG + Intergenic
1055829527 9:80361134-80361156 CAGTCCTCTAAGAAGATGTAGGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056931147 9:90878646-90878668 TTGTTGTTTAAGAAGAGGGAAGG + Intronic
1057639649 9:96805896-96805918 ATTTCCTCTAAGACAAGGCAAGG + Intergenic
1058231709 9:102434517-102434539 ATGTGTTCTAAGAAAAGGGAGGG - Intergenic
1060045959 9:120340926-120340948 ATGGCCTCTAAGAAACTGGAGGG + Intergenic
1061858610 9:133456527-133456549 ATGTCCCCTAGGAAGCGGCAGGG - Exonic
1062527531 9:136984368-136984390 ATGTCCTCTAAGGATTGTGAGGG + Intronic
1186710520 X:12191102-12191124 ACGTCATCAAAGAAGAGAGATGG + Intronic
1187743895 X:22387536-22387558 CAGTCACCTAAGAAGAGGGAGGG - Intergenic
1190539711 X:51464349-51464371 ATATGCTCTAAGGAAAGGGATGG - Intergenic
1192366705 X:70479815-70479837 ATGTGCCCTAGGAAGAGGGAGGG + Intronic
1192623655 X:72705497-72705519 ATGTCCTCTAATAGGATGGTTGG - Intronic
1192702345 X:73488377-73488399 ATGTCCTCTGTGAACAGGGATGG - Intergenic
1192843339 X:74880381-74880403 ATGGCCTAAGAGAAGAGGGAAGG + Intronic
1197758041 X:130009970-130009992 AAATCCTCTGAGAAGAGGGGTGG - Intronic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1198090955 X:133329438-133329460 AGGTCTTCTAAGAAGACGCAAGG + Intronic
1198119574 X:133578864-133578886 ATGTCTGCTATGGAGAGGGATGG + Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1201526704 Y:14944115-14944137 ATAACCTCTAAGAAGAGAGGTGG + Intergenic
1201713125 Y:17013858-17013880 ATATCCTCCAAGAAGAGAGAAGG + Intergenic