ID: 1070951981

View in Genome Browser
Species Human (GRCh38)
Location 10:80438573-80438595
Sequence GGTTTAACTGGACTAGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070951981_1070951989 5 Left 1070951981 10:80438573-80438595 CCAGATCCTAGTCCAGTTAAACC No data
Right 1070951989 10:80438601-80438623 CTCTGGGGCTGGATCGATCCAGG No data
1070951981_1070951986 -10 Left 1070951981 10:80438573-80438595 CCAGATCCTAGTCCAGTTAAACC No data
Right 1070951986 10:80438586-80438608 CAGTTAAACCAGAATCTCTGGGG 0: 2
1: 10
2: 89
3: 297
4: 813
1070951981_1070951987 -6 Left 1070951981 10:80438573-80438595 CCAGATCCTAGTCCAGTTAAACC No data
Right 1070951987 10:80438590-80438612 TAAACCAGAATCTCTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070951981 Original CRISPR GGTTTAACTGGACTAGGATC TGG (reversed) Intergenic
No off target data available for this crispr