ID: 1070954350

View in Genome Browser
Species Human (GRCh38)
Location 10:80454508-80454530
Sequence CCGCGGGGCCGCTCCTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070954350_1070954363 20 Left 1070954350 10:80454508-80454530 CCTGCCCAGGAGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 247
Right 1070954363 10:80454551-80454573 CAGGATTGCTCGCTAGAGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 63
1070954350_1070954361 16 Left 1070954350 10:80454508-80454530 CCTGCCCAGGAGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 247
Right 1070954361 10:80454547-80454569 CTGCCAGGATTGCTCGCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1070954350_1070954360 1 Left 1070954350 10:80454508-80454530 CCTGCCCAGGAGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 247
Right 1070954360 10:80454532-80454554 CGGCGCTGGCTTTGTCTGCCAGG 0: 1
1: 0
2: 1
3: 4
4: 129
1070954350_1070954364 23 Left 1070954350 10:80454508-80454530 CCTGCCCAGGAGCGGCCCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 247
Right 1070954364 10:80454554-80454576 GATTGCTCGCTAGAGGTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070954350 Original CRISPR CCGCGGGGCCGCTCCTGGGC AGG (reversed) Intronic