ID: 1070956474

View in Genome Browser
Species Human (GRCh38)
Location 10:80466973-80466995
Sequence TTCTGCTGACTCTAAATTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070956474_1070956478 18 Left 1070956474 10:80466973-80466995 CCAAAAATTTAGAGTCAGCAGAA No data
Right 1070956478 10:80467014-80467036 AAGTCCGTTAACCAATACACTGG No data
1070956474_1070956477 -5 Left 1070956474 10:80466973-80466995 CCAAAAATTTAGAGTCAGCAGAA No data
Right 1070956477 10:80466991-80467013 CAGAAAGGACTGGTAAGATAAGG No data
1070956474_1070956479 19 Left 1070956474 10:80466973-80466995 CCAAAAATTTAGAGTCAGCAGAA No data
Right 1070956479 10:80467015-80467037 AGTCCGTTAACCAATACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070956474 Original CRISPR TTCTGCTGACTCTAAATTTT TGG (reversed) Intronic
No off target data available for this crispr