ID: 1070956742 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:80468896-80468918 |
Sequence | GGCAAGCATGACAGTGTGGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1070956742_1070956747 | 4 | Left | 1070956742 | 10:80468896-80468918 | CCAGCCACACTGTCATGCTTGCC | No data | ||
Right | 1070956747 | 10:80468923-80468945 | CGCTTTGTTAGCCTGTTTCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1070956742 | Original CRISPR | GGCAAGCATGACAGTGTGGC TGG (reversed) | Intronic | ||