ID: 1070956742

View in Genome Browser
Species Human (GRCh38)
Location 10:80468896-80468918
Sequence GGCAAGCATGACAGTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070956742_1070956747 4 Left 1070956742 10:80468896-80468918 CCAGCCACACTGTCATGCTTGCC No data
Right 1070956747 10:80468923-80468945 CGCTTTGTTAGCCTGTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070956742 Original CRISPR GGCAAGCATGACAGTGTGGC TGG (reversed) Intronic