ID: 1070957140

View in Genome Browser
Species Human (GRCh38)
Location 10:80471665-80471687
Sequence CTTCAATGGCAGAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070957134_1070957140 -2 Left 1070957134 10:80471644-80471666 CCCTTGAGTGGGCAGCTTCACCT 0: 1
1: 0
2: 1
3: 12
4: 140
Right 1070957140 10:80471665-80471687 CTTCAATGGCAGAGGGAAGTAGG No data
1070957131_1070957140 9 Left 1070957131 10:80471633-80471655 CCTAGCATCCTCCCTTGAGTGGG 0: 1
1: 0
2: 2
3: 17
4: 141
Right 1070957140 10:80471665-80471687 CTTCAATGGCAGAGGGAAGTAGG No data
1070957129_1070957140 19 Left 1070957129 10:80471623-80471645 CCTGCTTTGGCCTAGCATCCTCC 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1070957140 10:80471665-80471687 CTTCAATGGCAGAGGGAAGTAGG No data
1070957135_1070957140 -3 Left 1070957135 10:80471645-80471667 CCTTGAGTGGGCAGCTTCACCTT 0: 1
1: 0
2: 1
3: 19
4: 176
Right 1070957140 10:80471665-80471687 CTTCAATGGCAGAGGGAAGTAGG No data
1070957133_1070957140 1 Left 1070957133 10:80471641-80471663 CCTCCCTTGAGTGGGCAGCTTCA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1070957140 10:80471665-80471687 CTTCAATGGCAGAGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070957140 Original CRISPR CTTCAATGGCAGAGGGAAGT AGG Intronic
No off target data available for this crispr