ID: 1070961511

View in Genome Browser
Species Human (GRCh38)
Location 10:80503097-80503119
Sequence CTGGGGGCCTTGAATAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1070961496_1070961511 27 Left 1070961496 10:80503047-80503069 CCATGAGGAAAAGTCTTGGCCTC 0: 1
1: 0
2: 0
3: 20
4: 188
Right 1070961511 10:80503097-80503119 CTGGGGGCCTTGAATAAGATGGG No data
1070961502_1070961511 5 Left 1070961502 10:80503069-80503091 CCAGCTTTGGCAAGAGGGAGGCA 0: 1
1: 0
2: 1
3: 26
4: 335
Right 1070961511 10:80503097-80503119 CTGGGGGCCTTGAATAAGATGGG No data
1070961500_1070961511 8 Left 1070961500 10:80503066-80503088 CCTCCAGCTTTGGCAAGAGGGAG 0: 1
1: 0
2: 2
3: 41
4: 377
Right 1070961511 10:80503097-80503119 CTGGGGGCCTTGAATAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1070961511 Original CRISPR CTGGGGGCCTTGAATAAGAT GGG Intronic
No off target data available for this crispr